Read Microsoft Word - newp.doc text version

Molecular detection and identification of a prokaryotic pathogen associated with Al-Wijam declining disease of date palms in Saudi Arabia

(Accepted: 08.02. 2002)

1

Food and Agriculture Organization of the United Nations, UTFN/SAU/002/SAU-Riyadh, Saudi Arabia; 2Department of Extension, Agricultural Services, Ministry of Agriculture and Water, Riyadh, Saudi Arabia; 3Fruit Laboratory, Agriculture Research Service, U.S. Department of Agriculture, Beltsville, MD 20705 USA; 4Department of Plant Protection College of Agriculture and Food Sciences, King Faisal University, Al-Hassa, Saudi Arabia

M. M. El-Zayat1,2, A.M. Shamloul, K.S. Abdulsalam4, M. Djerbi1 and A. Hadidi3

ABSTRACT Al-Wijam is an economically important disease that has caused the decline of date palms in the eastern region of Saudi Arabia (SA). It is also a major threat to date palm plantations at other regions in the country due to movement of infected palm offshoots. To detect and identify the pathogen associated with the disease as a possible phytoplasma or phytoplasma-like agent, we isolated total nucleic acids (DNA) from diseased date palm tissue, amplified diseasespecific DNA by polymerase chain reaction (PCR) using universal primers for phytoplasma 16S rDNA. The amplified DNA was then analyzed by restriction fragment length polymorphism (RFLP) or cloned and its nucleotide sequence was determined. Leaf and fruit samples from Al-Hassa in the eastern region of SA were employed in first round and nested PCR assays; peach phytoplasma was used as a positive control. Two sets of universal primer pairs that amplify sequences in the phytoplasma 16S rDNA were employed. Few positive amplifications were obtained by first round PCR from diseased date palm samples, however, all diseased samples were tested by nested PCR. Amplification with the primer pair (R16F2n/R16R2) in nested PCR yielded 1.2 kb and 1.4 kb 16S rDNA fragments from phytoplasma-infected peach samples and Al-Wijam diseased tissues, respectively. No amplified product was obtained from healthy peach or date palm tissue. RFLP, nucleotide sequence and cladistic analyses of the amplified 16S rDNA suggested that Al-Wijam disease organism may be classified as a new distinct phytoplasma, which is most similar to group IV phytoplasmas, that include coconut lethal yellowing phytoplasma. The 16S rDNA of the latter phytoplasma, however, shares only 88% identity with that of Al-Wijam disease organism. This finding and the synthesis of 1.4 kb but not 1.2 kb PCR product from Al-Wijam disease organism may suggest a border line classification for the pathogen associated with Al-Wijam disease as a phytoplasma and it also opens the possibility that the disease may be caused by a bacterium. Alternatively, the Al-Wijam disease pathogen may be evolutionary related to both phytoplasmas and bacteria. Keywords: Al-Wijam, bacteria, date palms, declining, nucleotide sequence, PCR, phylogony, phytoplasma, RFLP, uncultural mollicutes, 16S rDNA.

Arab J. Biotech., Vol. 5, No.(2) July (2002): 193-206.

194

M.M. El-Zayat et al.

INTRODUCTION ate palm (Phoenix dactylifera L.) is an important fruit crop in the great desert areas world-wide. It is a dioecious, monocot plant species that belongs to the family Arecaceae. The area planted with date palm in Saudi Arabia (SA) has reached 95,344 hectares where 18.2 million grown trees produce 601,000 tons of date annually. The eastern region, on the Arabian Gulf, is one of the most important regions for date palms for centuries. More than 3 million trees are grown at Al-Hassa Oasis in Hofuf and 465,000 at Qatif. Date palms in SA are generally affected by fungal diseases, but since 1945 a new disease of unknown etiology has been recorded in the eastern region at al-Hassa and Qatif Oases, which is causing decline of date palm trees. The disease is known as Al-Wijam (lit. destructive and fatal). The disease has become a limiting factor in increasing production of dates in these areas and a major threat to date palm plantations in other regions of SA due to the movement of infected offshoots. Al-Wijam disease was first recorded in Al-Hassa Oasis in 1945 (Elarosi, 1989). The disease occurrence was recognized by growers for many years prior to that date. In 1952, it was recommended that offshoots of diseased palms should be avoided for propagation (AlBakr, 1952). The symptoms of this disease were attributed to a high water level, unfavorable soil conditions, or an agent of viral etiology (Nixon, 1954). Elarosi (1989), and Abdulsalam et al. (1992; 1993; 1996) reported the association of fungi and nematodes with the roots of Al-Wijam diseased date palms. However, they were unable to show that the pathogens isolated caused the disease. It was suggested that AlArab J. Biotech., Vol. 5, No.(2) July (2002): 193-206.

D

Wijam disease my be caused by mycoplasmalike organisms (presently known as phytoplasmas), as application of 20 g of oxytetracycline per an infected date palm tree partially controlled the disease (Abdulsalam et al., 1993). Phytoplasmas have been reported to be associated with a few palm diseases; lethal yellowing disease that affects coconut palms and date palms in the Caribbean region, Florida and Texas (Djerbi, 1991; Harrison et al., 1992; 1994), kaincope disease of coconut palm in Togo (McCoy, 1976), a slow decline disease, known as Arkish disease and white tip diebak, has become a limiting factor in date production in Sudan. (Dabek, 1993; Conje et al., 2000). Djerbi (1991; 1995) suggested that brittle leaf disease of date palm in Tunisia and Algeria may be caused by phytoplasma. In this paper, we report on symptoms and epidemiology of Al-Wijam declining disease of date palms in SA as well as on polymerase chain reaction (PCR) detection and identification of a prokaryotic pathogen associated with the disease. The classification and taxonomic characterization of the pathogen are discussed. MATERIALS AND METHODS Source of plant material Leaves and fruits were collected from healthy and Al-Wijam-affected date palm trees grown at Al-Hassa Oasis in the eastern region of SA. Extraction of total nucleic acids from date palm tissues Nucleic acids were extracted from diseased and healthy palm tissues by a modified method of that described by Lee et

Al-Wijam disease of date palm in S. Arabia

195

al. (1993). Briefly, date palm leaf or fruit tissue was washed with 0.1% bleach solution (stock solution contained 5.25% sodium hypochlorite) for 10 min, then rinsed with sterile distilled water (3x3 min), and the surface was dried well. Two hundred grams of tissue were placed in dry cold mortar and ground to a fine powder with liquid nitrogen. Fourteen ml of grinding buffer (95 mM K2HPO4. 3 H2O; 30 mM KH2PO4; 10% sucrose; 0.15% BSA [bovine serum albumin]; 2% PVP-10 [polyvinylpyrollidone]; and 0.5% ascorbic acid, pH 7.6) were added and ground thoroughly. The mixture was centrifuged at 20,000 xg at 4 °C for 20 min and supernatant was discarded. Eight ml of extraction buffer (100 mM Tris-HCl, pH 8.0, 100 mM EDTA [ethylenediaminetetraecetic acid], and 250 mM NaCl), and 160 µl of 5 mg/ml proteinase K were added to the pellet and mixed with 880 µl of 10% sarkosyl. The mixture was centrifuged at 4400 xg for 10 min at 4 °C to pellet debris, the supernatant was transferred to a clean tube and precipitated with a 0.6 volume of cold isopropanol during incubation for 30 min at - 20 °C. The pellet was resuspended in 3 ml of TE buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA), mixed with 75 µl of 20% SDS (sodium dodecyl sulfate) and 60 µl of proteinase K (5 mg/ml), and incubated at 37 °C for 30 min. The mixture was mixed thoroughly with 525 µl of 5M NaCl, 420 µl CTAB (hexacetylmethylammonium bromide) in 0.7 M NaCl was added and incubated at 65 °C for 10 min. An equal volume of chloroform/isoamyl alcohol (CIA) (24:1) was added, vortexed and centrifuged at low speed (4,000 xg) for 5 min. The aqueous phase recovered was mixed with an equal volume of phenol/CIA, vortexed and centrifuged at low speed for 5 min at 4 °C. Total nucleic acids were precipitated with 0.6 volume of isopropanol, incubated at -20 °C for

Arab J. Biotech., Vol. 5, No.(2) July (2002): 193-206.

30 min, and centrifuged at 10,000 xg for 10 min at 4 °C. The pellet was washed with 70% ethanol, vacuum dried and resuspended in 200 µl TE buffer. An alternative method was used to extract DNA from date palm tissue using BIO 101 kit as recommended by the manufacture (BIO 101, Carlsbad, CA). About 100 mg of palm leaf tissue were cut into small pieces and powdered with liquid nitrogen. Leaf powder was transferred to a 1.5 ml Eppendorf tube and mixed with 800 µl of CLS-VF and 200 µl of PPS. The mixture was vortexed for 1 min, then centifuged for 5 min at 14,000 xg to pellet the proteins and debris. About 600 µl of the supernatant were transferred to a clean tube. The supernatant was mixed with 600 µl of binding matrix, incubated for 5 min at room temperature, and pulse spun for 5 seconds to pellet binding matrix which contained DNA; supernatant was discarded. The pellet was resuspended gently in 500 µl salt/ethanol wash solution. After centrifugation for 1 min, the supernatant was discarded. Total DNA was eluted by resuspending the binding matrixDNA complex in 100 µl of DEPC (diethylpyrocarbonate)-treated water. The mixture was centrifuged for 1 min at 12,000 xg and the supernatant containing the DNA was transferred to a clean tube. PCR amplification, cloning and sequencing PCR amplification was done essentially as described by Gunderson et al. (1994). The phytoplasma universal primers R16mF2/R16mR1 (R16mF2, 5`CATGCAAGTCGAACGA-3`; R16mR1, 5`CTTAACCCCAATCATCGAC-3') were used as first round primers; and the universal primers R16F2n/R16R2 (R16F2n, 5`GAAACG ACTGCTAAGACTGG-3`;R16R2, 5'-TGACGGGCGGTGTGTACAAACCCCG3') were used as nested primers. Ampli Taq

196

M.M. El-Zayat et al.

Gold DNA polymerse was used for amplification of high fidelity PCR products. The parameters used for PCR amplification were: denaturation at 94 °C for 1 min (12 min for first cycle to activate the polymerase), annealing at 60 °C (55 °C for nested PCR) for 2 min, and then extension at 72 °C for 3 min (7 min in the final cycle) for 35 cycles. One µl of direct PCR product was diluted (1:30) in water and 5 µl of the diluted sample were used as template for the nested PCR. The nested PCR amplified products were isolated from 5% polyacrylamide gel, purified by the crush and soak method (Sambrook et al., 1989), and then cloned into the EcoRI site of pCRII-TOPO vector as suggested by the manufacturer (Invitrogen, Carlsbad, CA). Both strands of the DNA fragments were sequenced by ABI-PRISMTM 373 A Genetic Analyzer (Perkin Elmer) by using dye-primer and dye-terminator methods at the University of Maryland (DNA Sequencing Facility/Center for Agricultural Biotechnology, USA). RFLP analysis Four to 8 µl (100-200 ng DNA) of nested PCR product were digested with the following restriction endonucleases according to the manufacturer's instructions: MseI, AluI, HeaIII, RsaI, HpaII, HhaI, HpaI, EcoRI, Hinf I, or Sau3AI. The digested product of each sample was separated by electrophoresis on 2% agarose gel. Sequence alignment and phylogenetic tree construction Nucleotide sequences were aligned by

the ClustalW method, EMBL (http://www.ebi.ac.uk) with 16S rDNA sequences of known phytoplasmas (Zhu et al., 1998). The resulting alignments were visually inspected for logical placement of gaps and manually adjusted, if necessary, to conserve sequence patterns and secondary structure. Uninformative characters were excluded from the analyses. A phylogenetic tree was constructed by a heuristic search via random stepwise addition implementing the tree bisection and reconnection branch-swapping algorithm to find the optimal tree(s). Anaeroplasma bactoclasticum was chosen as the out group to root the tree. The analyses were replicated many times. Bootstrapping (Felsenstein, 1987) was performed to estimate the stability support of the clades. RESULTS Symptoms of Al-Wijam declining disease Characteristic symptoms appear as stunted growth with yellow streaking of leaves, followed by reduction of date production, and eventual death of affected trees. The newly appearing leaves are shorter, narrower and stiffer than those early formed in previous years. Leaf symptoms include a reduction in the length and thickness of petiole or leaf base, midrib (rachis) and pinnae. Diseased leaves are marked by a continuous annual reduction in their curvature along the leaf stalks thus showing rosetting symptoms (Fig. 1A), and by yellow streaking of the petiole, the midrib and the pinnae (Fig. 1B). Later, the whole leaf becomes chlorotic, its life span is reduced and necrosis begins from its distal end towards the leaf base (Fig. 1A).

Arab J. Biotech., Vol. 5, No.(2) July (2002): 193-206.

A

Al-Wijam disease of date palm in S. Arabia

197

B

C

Fig. (1): Symptoms of Al-Wijam declining disease of date palm. (A) the terminal bud growth of diseased palm tree becomes retarded which affect the appearance of the newly formed infected leaves as they appear to be arising from the trunk at nearly the same level and the whole bunch of leaves formed have rosetting symptoms; (B) diseased leaves are marked by yellow streaking(right) and later become chlorotic; (C) fruit stalks of bunches are short and the circumference of the fruit stalk is reduced in length. The branched part of the spadix is also reduced in length and the number and length of strands are also reduced.

Arab J. Biotech., Vol. 5, No.(2) July (2002): 193-206.

198

M.M. El-Zayat et al.

At the same time, there is a pronounced reduction in length of spadices depending on the cultivar of date palm. This includes a diminishing of the length and circumference of fruit stalks and the length and number of the fruit stands (Fig. 1C). The diseased date palms may show activation of the aerial vegetative axially buds that give rise to aerial malformed poorly developed offshoots with shorten leaves. Also, adventitious roots around the palm tree are lacking and a brown discoloration and decay is evident on some of the root system. Finally, retardation in growth of the terminal bud occurs as the formation of leaves and spadices are reduced gradually in few years until the growth of the date palm tree ceases and eventually dies. Epidemiology of the disease A survey of Al-Wijam disease was carried out at 68 date palm farms in 22 villages of Al-Hassa Province. The disease was present on 49 farms (72 %) and there was 328 diseased palm trees out of total 11,006 trees examined. The average percent of diseased trees at different locations was about 3%. The highest percentage of the disease (11.11%) was recorded at Al-Helialah, followed by AlMarkaz (10.53%), Batliah (6.82%), AlMobarraz (5.14%), Al-Shobah (3.37%), AlHofouf (1.7%), and less than 1.7% at each of the other locations. The disease was detected on all 17 date palm tree cultivars present in the region. The disease was detected on date palm offshoots as well as on mature and old trees. PCR amplification Using the first round universal primer pair R16mF2/R16mR1, an amplified PCR product of about 1.6 kb in size was obtained from total DNA of Al-Wijam- infected plants (data not shown). When nested primer pair R16F2n/R16R2 was then used for reArab J. Biotech., Vol. 5, No.(2) July (2002): 193-206.

amplification, an amplified PCR product of about 1.4 kb in size was obtained from date palm leaf midrib, leaflets, and fruit (Fig. 2, lanes 2, 3 and 4, respectively). No amplified product was obtained from apparently healthy palm tissues (Fig. 2, lane 5). When total DNA from phytoplasma-infected peach leaves was used as a control, an amplified PCR product of about 1.2 kb in size was obtained (Fig. 2, lane 1).

1500 bp

Fig. (2): Gel electrophoretic analysis of nested PCR products amplified from the pathogen associated with AlWijam disease: pathogen-infected date palm leaf midrib, leaflet, and fruit (lanes 2, 3, and 4, respectively); apparently healthy date palm tissue (lane 5). Phytoplasma-infected peach tissue control (lane 1). High molecular weight DNA marker: 3000, 2500, 2000, 1500, and 1000 bp (lane M). RFLP analysis When the DNA of Al-Wijam's agent (WJ) was amplified with R16F2n/R16R2 primers and digested with either MseI, AluI, HeaIII, RsaI, HpaII, HhaI, HpaI, EcoRI, HinfI, or Sau3AI endonucleases, a different RFLP profile was obtained for each enzyme (Fig. 3). The putative restriction sites of WJ, coconut lethal yellowing phytoplasma (LY) and the Canadian X-disease phytoplasma of cherry and peach (CX) were compared using

Al-Wijam disease of date palm in S. Arabia

199

EcoRI, BamHI I, or HpaI restriction endonucleases. When BamHI restriction endonuclease was used, the RFLP profile of WJ DNA or LY DNA was similar but not identical (Fig. 4, lanes 4 and 6, respectively), which suggested the presence of at least one BamHI recognition site in LY DNA. These results, however, were significantly different from that of BamHI- restricted CX DNA (Fig. 4, lane 5). When EcoRI or HpaI endonuclease

was used for digestion, the RFLP profile showed one cleavage site that cleaved the DNA into two major products (Fig. 4, lanes 13 and 7-9). However, the size of cleaved WJ DNA was slightly different from that of CX or LY DNA whether EcoRI or HpaI endonuclease was used for digestion which suggested that WJ DNA is different from that of CX or LY phytoplasma.

Fig. (3): Restriction profiles of WJ pathogen 16S rDNA amplified using universal R16F2n/R16R2 primers with 10 restriction endonucleases. M, DNA molecular marker Lane M, X 174 RFI DNA HaeIII digest, fragment sizes (bp): 1353, 1078, 872, 603, 310, 281, 271, 234, 194, 118, and 72. Fig. (4): EcoR I (lanes 1-3), BamH I (lanes 46), and Hpa I (lanes 7-9) restriction profiles of phytoplasma 16S rDNA amplified using universal R16F2n/R16R2 primers. Lanes 1, 4, and 7 WJ pathogen; lanes 2, 5, and 8 CX phytoplasma; lanes 3, 6, and 9 LY phytoplasma

Nucleotide sequence The nucleotide sequence of the 1356 bp DNA amplified from Al-Wijam diseased date palms was determined and compared with that

of the 16S rDNA of LY phytoplasma. The two DNAs are distinct as they share 88% identity (Fig. 5).

Arab J. Biotech., Vol. 5, No.(2) July (2002): 193-206.

200

LY WJ LY WJ LY WJ LY WJ LY WJ LY WJ LY WJ LY WJ LY WJ LY WJ LY WJ LY WJ LY WJ LY WJ

M.M. El-Zayat et al.

CATGCAAGTCGAACGGAAATCTTTTAGA-------------TTTTAGTGGCGAACGGGTG 47 CATGCAAGTCGAACGGAAATCTTTTAGAGAAATCTTTAAGATTTTAGTGGCGAACGGGTG 60

**************************** *******************

AGTAACACGTAAGCAACCTGCCTTTAAGACGAGAATAACAATTGGAAACAGTTGCTAAGG 107 AGTAACGCGTAATCAACCTGCCTTTCAGACGGGAATAACAAGTGGAAACCGTTGCTAATA 120

****** ***** ************ ***** ********* ******* ********

CTGGATAGGAAATAAAAAGGCATCTTTTTATTTTTAAAAG---ACCTTTTTCGGAAGGTA 164 CCGCGTACGATTCATAGAGGCATCGTTTTGTGAATGAAAGTGGGCCTTTTTCATAAGCTA 180

* * ** ** * * ******* **** * * **** ******** *** **

****

TGCTTAAAGAGGGGCTTGCGTCACATTAGTTAGTTGGTAGGGTAAAGGCCTACCAAGACG 224 TGCTGAAGGAGGGGATTGCGTCTGATTAGCTAGTTGGTAGGGTAACGGCCTACCAAGGCA 240

** ****** ******* ***** *************** *********** *

ATGATGTGTAGCTGGACTGAGAGGTTGAACAGCCACATTGGGACTGAGACACGGCCCAAA 284 ATGATCAGTAGCCGGACTGAGAGGATGAACGGCCACATTGGGACTGAGACACGGCCCAAA 300

***** ***** *********** ***** *****************************

CTCCTACGGGAGGCAGCAGTAGGGAATTTTCGGCAATGGAGGAAACTCTGACCGAGCAAC 344 CTCCTACGGGAGGCAGCAGTGGGGAATTTTCCGCAATGGACGAAAGTCTGACGGAGCAAC 360

******************** ********** ******** **** ****** *******

GCCGCGTGAACGACGAAGTACTTCGGTATGTAAAGTTCTTTTATTGAAGAAGAAACAATA 404 GCCGCGTGAGTGACGAAGGTCTTCGGTATGTAAAGCTCTTTTAATGGAGACGAAACAATT 420

********* * * * ** * * *************** ******* ** *** ********

**

GTGGAAAAACTATCTTGACGTTATTCAATGAATAAGCCCCGGCTAACTATGTGCCAGCAG 464 CTGTGTGAACTAACTTGACGTTATCCAATGAATAAGCCCCGGCTAACTACGTGCCAGCAG 480

***** *********** ************************ **********

CCGCGGTAATACATAGGGGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGGGTGCGTAG 524 CCGCGGTAATACATAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCGCGTAG 540

***************** *** ****** ************************ ******

GCGGTTTAATAAGTCTCTAGTTTAATTTCAACGCTTAACGTTGTCCTGCTAGAGAAACTG 584 GCGGCTTAATCAGTCTGTCGTTAAATTTCGGCGCTTAACGCTGTGCTGGGATGGAAACTT 600

**** ***** ***** * *** ****** ********* *** *** * ******

TTTAACTAGAGTGAGATAGAGGTAAGCGGAATTCCATGTGTAGCGGTAAAATGTGTAAAT 644 GTTGGCTAGAGTGACGGAGAGGTAAGCGGAATTCCATGTGTAGCGGTGAAATGCGTAAAT 660

** ********* ****************************** ***** ******

ATATGGAGGAACACCAGAGGCGTAGGCGGCTTACTGGGTCTTTACTGACGCTGATGCACG 704 ATATGGAAGAACACCAGAGGCGTAGGCGGCTTTCTGGATCAATACTGACGCTGATGCGCG 720

******* ************************ **** ** *************** **

AAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACTATGAGTA 764 AAAGCATGGGGAGCGAACGGGATTAGATACCCCGGTAGTCCTCGCCGTAAACGATGAGTA 780

***** ******** *** ************* ******** ********** *******

CTAAGTGTCGGGGTTAAACTCGGTACTGAAGTTAACACATTAAGTACTCCGCCTGAGTAG 824 CTAGGTGTGGAGGTTAGACTCTGTACTGAAGTTAACGCATTAAGTACTCCGCCTGGGTAG 840

*** **** * ***** **** ************** ****************** ****

Fig. (5): Nucleotide alignment of the 16 S rDNA nucleotide sequence of Al-Wijam pathogen (WJ) with the corresponding region of the 16S rDNA of coconut lethal yellowing phytoplasma (LY) (Accession no. U18747). Asterisks indicate the position of identity. WJ and LY rDNA shares 88% identity.

Arab J. Biotech., Vol. 5, No.(2) July (2002): 193-206.

Al-Wijam disease of date palm in S. Arabia

201

LY WJ LY WJ LY WJ LY WJ LY WJ LY WJ LY WJ LY WJ LY WJ

TACGTACGCAAGTATGAAACTTAAAGGAATTGACGGGATCCCGCA-CAAGCGGTGGATCA 883 TACGTACGCAAGGATGAAACTCAAAGGAATTGACGGGGTCCCGCATCAAGCGGTGGATCA 900

************ ******** *************** ******* **************

TGTTGTTTAATTCGAAGATACACGAAAAACCTTACCAGGTCTTGACATACTCTGCAAAGC 943 TGTGGTTTAATTCGAAGATACGCGAAGAACCTTACCAGGTCTTGACATACTC-GCGAAAC 959

*** ***************** **** ************************* ** ** *

TATAGAAATATAGTGGAGGTTATCAGGGATACAGGTGGTGCATGGTTGTCGTCAGCTCGT 1003 TAAAGAGTTTTTCTGGAGGCTATCAGGAATACAGGTGGTGCATGGCTGTCGTCAGCTCGT 1019

** *** * * ****** ******* ***************** **************

GTCGTGAGATGTTAGGTTAAGTTCTAAAACGAGCGCAACCCCTGTCGTTAATTGCCAGCA 1063 GTCGTGAGATGTTAGGTTAAGTTCCGAAACGAGCGCAACCCCTATCGTTAATTGCCAGCA 1079

************************ ***************** ****************

****

CGTTATGGTGGGGACTTTAGCGAGACTGCCAATGAAAAATTGGAGGAAGGTGGGGATTAC 1123 CGTTCGGGTGGGAACTCTAGAGAGACTGCCGCTGAAAATGTGGAGGAAGGCGGGGGTTAC 1139

****** *** *** ********* ****** ********** **** ****

GTCAAATCATCATGCCCCTTATGATCTGGGCTACAAACGTGATACAATGGCTATTACAAA 1183 GTCAAGTCATCATGCCCCTTATGACCTGGGCTACAAACGTGATACAATGGCTTTAATAAA 1199

***** ****************** *************************** * * ***

GAGTAGCTGAAACGCGAGTTTTCGGCAAATCTCAAAAAAATAGTCTCAGTTCGGATTGAA 1243 GAGAAGCTGAAACGCGCGAGATGGGCAAATCCCAAAAAAAGCGTCTCAGTTCGGATTGTA 1259

*** ************ * * ******** ******** **************** *

GTCTGCAACTCGACTTCATGAAGTTGGAATCGCTAGTAATCGCGAATCAGCATGTCGCGG 1303 GGCTGCAACTCGCCTTCGTGAAGTTGGAATCGCTAGTAATCGCGAGTCAGCATATCGCGG 1319

* ********** **** *************************** ******* ******

TGAATACGTTCTCGGGGTTTGTACACACCGCCCGTCA 1340 TGAATACGTTCCCGGGGTTTGTACACACCGCCCGTCA 1356

*********** *************************

Fig. (5): Continued

Phylogeny The nucleotide sequence of 16S rDNA gene of the pathogen associated with AlWijam disease was compared with those of over 40 phytoplasmas. Analysis revealed that the 16S rDNA of the Al-Wijam pathogen is most similar to that of group IV phytoplasmas, which also includes coconut lethal yellowing phytoplasma (LY). Both pathogens are distinct and unrelated to phytoplasma associated with the Canadian X-disease of cherry and peach (CX) which belongs to a different group.

DISCUSSION It was demonstrated that an rDNA fragment associated with Al-Wijam declining disease of date palms in SA was amplified by nested PCR using two pairs of phytoplasma universal primers. These primers also amplified a DNA fragment from peach tissue infected with phytoplasma; no amplification was observed with DNA from apparently healthy date palm or peach tissue. It has been also demonstrated that the amplified DNAs from infected date palm fruit, leaf midrib, or

Arab J. Biotech., Vol. 5, No.(2) July (2002): 193-206.

202

M.M. El-Zayat et al.

leaflets were identical in size (1.4 kb). This DNA was 0.2 kb larger than the DNA amplified from phytoplasma-infected peach tissue. These results suggest that the pathogens from date palms and peach trees are different and also suggest that date palms pathogen is systemically distributed in infected fruits and leaves. This is the first report of molecular evidence of the association of a prokaryotic pathogen, phytoplasma or phytoplasma-like agent, with Al-Wijam declining disease of date palm in SA. Total nucleic acids and DNA were extracted from date palm infected tissue using organic solvents and a fast DNA kit, respectively. Both methods were equally efficient in producing DNA suitable for nested PCR amplification of the pathogen DNA as long as date palm tissues were initially ground in liquid nitrogen. Thus, the fast DNA kit may replace the use of organic solvents for total DNA extraction. In addition to using the newly harvested or dried tissue, the fast DNA kit was also used for DNA extraction from infected frozen tissue after grinding in liquid nitrogen. These findings make detection studies of the pathogen from date palm easier to conduct. Indeed, this method was used successfully in SA for routine DNA extraction from date palms for PCR detection of the Al-Wijam pathogen as described in this investigation. Considering the difficulties of first round PCR assays in detecting the pathogen associated with Al-Wijam declining disease from date palm infected tissue, the sensitivity and specificity of detection were increased by utilizing nested PCR for re-amplification of the first round PCR product from palm tissue. The PCR assays developed in the investigation may be utilized for studying the epidemiology of Al-Wijam pathogen in date palm trees in SA, production of pathogen-tested date palm seedlings, and investigation of possible insect vector for the pathogen in Al-Hassa.

Arab J. Biotech., Vol. 5, No.(2) July (2002): 193-206.

The nucleotide sequence of the 1356 nucleotides of the 16S rDNA of Al-Wijam declining disease pathogen shares 88% identity with that of the 16S rDNA of coconut lethal yellowing phytoplasma (Accession no. U18747) and Carludovica palmata leaf yellowing phytoplasma (Accession no. AF237615) reported from infected plants in Florida and Mexico, respectively. This analysis may suggest that the Al-Wijam pathogen and the two other phytoplasmas are related but distinct. This conclusion may be substantiated by the fact that phylogenetic analysis of the 16S rDNA of Al-Wijam agent showed that it is a distinct phytoplasma belonging to group IV phytoplasmas whose members also include coconut lethal yellowing phytoplasma (Lee et al., 1998). Alternatively, 16S rDNAs are highly conserved across the phytoplasma clade and the homology between the Al-Wijam agent sequence and other phytoplasma sequences are on the limit as the extend of 16S rDNA variability across the phyoplasma clade is around 12-14%. The difference in size of the 16S rDNA product amplified from symptomatic date palm (1.4 kb) compared to the expected size (1.2 kb) of positive phytoplasma controls (Fig. 2) may suggest PCR detection of a phytoplasma-like organism such as a pathogenic bacterium. It may also suggest a phylogenetic relationships between the 16S RNA gene of Al-Wijam agent and other prokaryotes. Evolutionary relationships between plant-pathogenic phytoplasmas, Acholeplasma laidlawii, and other prokaryotes have been reported (Lima and Sears, 1992; Kuske and Kirkpatrick, 1992). More work is needed to establish whether the causal agent of Al-Wijam declining disease of date palms is a phytoplasma or a becterium. Preliminary experiments showed that the pathogen is phloem-restricted (K. S. Abdulsalam,

Al-Wijam disease of date palm in S. Arabia

203

unpublished). Phytoplasmas are known to be phloem-restricted as well as uncultured plant pathogenic bacteria such as the causal agent of citrus greening (Huanglongbing) disease (Hocquellet et al., 1999). Additional molecular experiments will be necessary to conduct to support the contention whether the rDNA sequence of Al-Wijam disease associated pathogen is of phytoplasmal or bacterial origin. ACKNOWLEDGEMENTS Our appreciation to D.E. Gundersen for advice in the phlylogenetic analysis of AlWijam pathogen 16S rDNA and I-M Lee for kindly providing the coconut lethal yellowing and Canadian X disease phytoplasmas. The technical assistance of P. Gaush and A. M. Shamloul is greatly acknowledged. This investigation was supported by grant MS-3-8 from King Abdul Aziz City for Sciences and Technology (KACSTSA). REFERENCES Abdulsalam, K.S., Najeeb, M.A., Rezk, M.A. and Abdel-Megeed M.I. (1992). Survey of certain fungi associated with Wijamed date palm trees in Al-Hassa Oasis of Saudi Arabia. Annals of Agric. Sci., Fac. Agric., Ain Shams Univ., Cairo, Egypt, 37: 603-611. Abdulslam, K.S., Abdel-Megeed, M.I., Rezk, M.A. and Najeeb, M.A. (1993). The influence of oxytetracycline on Wijamed date palm trees. Annals of Agric. Sci., Fac. Agric., Ain Shams Univ., Cairo, Egypt. 38: 301-309. Abdulsalam, K.S., Rezk, M.A., Najeeb, M.A. and Abdel-Megeed, M.I. (1996). Survey of certain pathogenic nematodes associated with Wijamed date palm trees in Al-Hassa Oasis of Saudi Arabia. The Third

Arab J. Biotech., Vol. 5, No.(2) July (2002): 193-206.

Symposium on Date palm in K.S.A., AlHassa, Saudi Arabia, P 17-20. Al-Bakr, A.J. (1952). Report to the Government of Saudi Arabia on date cultivation. FAO report 31. FAO Rome, PP 25. Conje, P., Deback, A.J., Jones, P. and Tymon, A.M. (2000). Slow decline: a new disease of mature date palm in North Africa associated with Phytoplasma. Plant Pathology, 49: 804. Dabek, A.J. (1993). Report on a consultancy to survey date palm diseases in the Northern Sudan. FAO Report, Rome, Italy, PP 51. Djerbi, M. (1991). Disease of date palm. AlWatan Printing Press Co. Beirut, Lebanon. Djerbi, M. (1995). Precis de Phoeniciculture. FAO Report, PP 192. Elarosi, H. (1989). Studies on plant diseases affecting date palm trees at the Eastern Province of Saudi Arabia. King Abdulaziz City for Science and Technology, Riyadh, KSA, Book No. 26. Felsenstein, J. (1987). Confidence limits on phylogenies: an approach using the bootstrap. Evolution, 39: 783-791. Gundersen, D.E., Lee, I. -M., Rehner, S.A., Davis, R.E. and Kingbury, D.T. (1994). Phylogeny of mycoplasma-like organisms (phytoplasmas): a basis for their classification. J. Bacteriol., 176: 5244-5254. Harrison, N.A., Bourne, C.M., Cox, R.L., Tsai, J.H. and Richardson, P.A. (1992). DNA probes for detection of mycoplasmalike organisms associated with lethal yellowing disease of palm in Florida. Mol. Plant Pathol., 82: 216-224. Harrison, N.A., Richardson, P.A., Kramer, J.B. and Tsai, J.H. (1994). Detection of the mycoplasma-like organism associated with lethal yellowing disease of palms in Florida by polymerase chain reaction. Plant Pathology, 43: 998-1008.

204

M.M. El-Zayat et al.

Hocquellet, A., Bove, J.M. and Garnier, M. (1999). Isolation of DNA from the uncultured "Candidatus liberobacter" species associated with citrus Huanglongbing by RAPD. Current Microbiology, 38: 176182. Kuske, C.R. and Kirkpatrick, (1992). Phylogenetic relationships between the western aster yellows mycoplasma-like organisms and other prokaryotes established by 16S rRNA gene sequence. Int. J. Syst. Bacteriol., 42: 226-233. Lee, I.-M., Davis, R.E., Sinclair, W.A., DeWitt, N.D. and Conti, M. (1993). Genetic relatedness of mycoplasma-like organisms detected in Ulmus spp. in the United States and Italy by means of DNA probes and polymerase chain reactions. Phytopathol., 83: 829-833. Lee, I.-M., Gunderson, D.E., Davis, R.E. and Bartoszyk, I.M. (1998). Revised classification scheme of phytoplasmas based on RFLP analysis of 16S rDNA and ribosomal protein gene sequences. Int. J.

Syst. Bacterio., 48: 1153-1169. Lima, P.O. and Sears, B.B. (1992). Evolutionary relationships of a plantpathogenic mycoplasma-like organism and Acholeplasma laidlawii deduced from two ribosomal protein gene sequences. J. Baceriol., 174: 2606-2611. McCoy, R.E. (1976). Comparative epidemiology of the lethal yellowing, Kaincope and cadang-cadang diseases of coconut palm. Plant Dis. Rep., 60: 498-502. Nixon, R.W. (1954). Date varieties of the eastern province of Saudi Arabia in relation to cultural practices. USA Operations Mission to Saudi Arabia, pp 33. Sambrook, J., Fritch, E.F. and Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd ed. Cold Spring Laboratory Press, Cold Spring Harbor, N.Y. Zhu, S.F., Hadidi, A., Lee, I-M., Gundersen, D.E. and Zhang, C. (1998). Characterization of the phytoplasma associated with cherry lethal yellows and jujube witches'-broom diseases in China. Acta Hort., 472: 701-714.

Arab J. Biotech., Vol. 5, No.(2) July (2002): 193-206.

Al-Wijam disease of date palm in S. Arabia

205

!" $ % # &' ,$ , , .

­

' . $ / 9 8! 3 * &% 8 0 1

($ * ) +

FAO ­ ­ ! " # $

% & ( %

­ )* + ,

-

+ % )& -% + 2 %3 # $4 *% 2 ( / Al-Wijam % 8 * )7 + ) % - % / 5 & 61 + % )& ( 7 * ! %) & - / DNA ) % 0 <phytoplasma; ' %+ / / ) % + $ 4 *' : 3 9 % 8 8 )8 $% 5 - 4 16S rDNA ) % ) " 1 % = & amplifying -% % 4 % % % $% % % %, RFLP) 4 nested > & 8 PCR ) /8 > ? ( >+ 6 >+ 4 . [email protected] 0 / 1 &A B 6 / ( ) % % 0 2 C & ' %+ ( % " 8 8* & ( % $ % -% .D / / - ) % 0 (Positive control; 3 / 4 : )& ( / 4 PCR ) > ? >+ ( -% / ) > ) * $ / E 0 16S rDNA PCR ) >8 + <R16F2n/R16R2; .D 8 G 1 DNA ) -% / nested > & PCR 1 ( F - % & Al-Wijam * C & ( / 16S rDNA " / $ ! 1 F1 0 > 1 E4 nested > & > % > 3 16S rDNA " $ 7 - ) $% F - I %% 0 % , C & ( / -% H% > ) * $ % 8 8 ' %+ > ) % % >% 4 IV ' %" / - > 2 ' %" / - >: * E 3 8 = 8 & , 8 F 0 1% >+ J )B % 2 &? ' %" 16S rDNA " / ­ ! $ -)& ( " * I % 0 3 / PCR ) H% / 6 , 0 K 10 46 , 1 F10 6 &% , -% 2/ 83 / +) ­ % > D 3 2/ L% E 4 ' %" " ! >: 3 > 0 $ % % ' %" / ) 1 % 1% $ / /

Arab J. Biotech., Vol. 5, No.(2) July (2002): 193-206.

Information

Microsoft Word - newp.doc

13 pages

Find more like this

Report File (DMCA)

Our content is added by our users. We aim to remove reported files within 1 working day. Please use this link to notify us:

Report this file as copyright or inappropriate

1043559