Read Microsoft PowerPoint - biochip.ppt [Compatibility Mode] text version

11/14/2007

Engineering of Biosystems for Detection of Listeria monocytogenes in Foods Michael Ladisch, Arun Bhunia, Rashid Bashir, Paul Robinson, Richard Linton

Center for Food Safety Engineering Agricultural and Biological Engineering Electrical and Computer Engineering Biomedical Engineering Food Science Laboratory of Renewable Resources Engineering Purdue University

Acknowledgments

Dr. Jim Lindsay, Dr. Shu-I Tu USDA Cooperative Agreement ARS 1935-42000-035 Eastern Regional Research Center Center for Food Safety Engineering

Andres Rodriguez, LORRE and ABE Bruce Applegate, Department of Food Science, Dr. Mira Sedlak, LORRE, for transforming L. monocytogenes and E. coli with RFP and GFP genes. Nate Mosier, ABE

Co-founders of Biovitesse include Michael Ladisch and Rashid Bashir; Arun Bhunia is a consultant for Biovitesse

Acknowledgements

· All past students and researchers · Adam Wright, David Suang, Jaeho Shin, Nathaniel Frank, Peter McKinnis, Thomas kreke, Xingya (Linda) Liu, Andres Rodriguez · Ok Kyung Koo, Kristin Burkholder, Balamurugan Jagadeesan, Sarimar Medina, and Krishna Mishra · Priya Banada, Shantanu Bhattacharya, Yi-Shao Liu, Shuaib Salamat, Demir Akin

Outline

Introduction and Background: Goals Rapid Cell Concentration and Recovery (CCR) Membrane Systems: Fouling and bacterial capture Mammalian cell receptor for capture of pathogens on biochip/biosensor surface Microfluidics device design for pathogen detection: systems Integration of biochip functions Conclusions/Next steps

Biochip Detection Process

100-250ml fluid 100ul fluid (w. cells) Biochip sensor Readout

Goals

Detect low levels of foodborne pathogens

in complex and various foods and in quick and precise way

Sample

· · · · Water Food Air Body Fluids

Off-chip Concentration

Detection/ ID

Data Analysis/ Results

Sample 100 ­ 250 ml

Automated Off-Chip Cell Concentration And Recovery - 1000X

Achieve rapid sample preparation

On-Chip Processing

Electrical Detection of cell Growth

Scale-down of bioseparations couple to specific and rapid detection

Biochip: Buffers, Receptors, Devices

Amplify, detect, identify pathogens Sample volumes of 100 L at 10 cell level

~ 40 min

~ 30 min

~ 1- 3 hr

Goal: Total Time less than < 4 hours

Bashir et al, 2004

1

11/14/2007

Benchmarks (Metrics)

Concentrate sample containing bacteria Final concentration of 103 to 104 cells / mL Final viable cell count on chip > 10 cells Concentrate cells in 30 min Process samples in 60 min Maintain cell viability Introduce samples on chip, detect cells in 3 hr

Membrane Concentration Recognizing Role of Liquid Film

~700 cells / ml x 50 ml

Liquid film Membrane filter

Syringe holder

Assumption: 1mg=1 l

Membrane retains 15 l of liquid

Liquid film concentrates 104 cells into a volume of 15 l of liquid. Concentration factor equivalent to 6.7 x 106 cells / mL Challenges: membrane fouling, recovering viable cells after concentration

Chen et al, 2005

Flat Membrane CCR: 100 mL sample volume

Syringe pump (Harvard)

Minimum Number of Cells in Sample for Recovery by CCR

10

Required number of cells (Log 10 f cfu/mL) )

2000 cfu / ml

8.1 5.3 4.5 5.1 51 5.9 6.9

Air space Liquid/Sample 47 mm Filter holder Screen filter assembly

3.39

3.4

3.9

Waste container

Banada et al, 2007

1 0

Liu et al, 2005; Banada et al, 2007

2

4

6

8

10

To recover an inital cell number of (Log10 cfu/mL)

Larger Volumes = Higher Sensitivity

Flat membranes have limit of 120 mL before flow stops Moderating loss of permeation rate (flux) and increasing throughput 1. 1 Lipases and proteases may hydrolyze macromolecules believed to cause pore occlusion; improvement in permeability is small 2. High cross membrane fluid velocity 3. Low trans-membrane pressure drop Cross flow membrane configurations: hollow fiber, flat membrane Dead end filtration has limit of 120 mL. Cross flow an alternative option.

Cross Flow HF Microfiltration

­ Liquid solution passes through the HF membrane. Particles retained on the inner HF membrane surface and module surface. ­ Permeate flux decreases rapidly. ­ A fouling layer build-up causes the system to plug up

2

11/14/2007

Particle Transport

v y, v

v x, u

Boundary Conditions

· Boundary Condition at Membrane Wall:

· Zero Particle Transport · Transverse Fluid velocity is a function of trans-membrane pressure and the cake layer v v = f(TMP,) |membrane · This function is dependant on many system parameters and is not well characterized for many systems

= Particle volume fraction v u = axial velocity v v = transverse velocity

x = axial position y = transverse position D = hydrodynamic diffusion coefficient

(u ) (v ) + + D = 0 x y y dy

Axial Transverse Convection Convection Sheer Induced Hydrodynamic Diffusion

Sheer Induced Diffusion

Use the Navier-Stokes Equations to solve for the flow and pressure field. Balance particle transport to solve for particle concentration and cake layer Particulates transport occurs via convection and Sheer induced diffusion Equations coupled because flux is function of trans-membrane pressure and cake layer.

Sample inlet

Hollow Fiber Membranes

7 inch 3 inch Retentate side Tee Tubing Hollow fiber Permeate side

Same flowrates, much smaller cross-sectional area

Cross Flow System

Bacterial Recovery

Initial test was done with E. coli GFP Use of Hollow Fiber System (HST) cross-flow, 0.45 µm pore size

Pump

Done with hot dog massage 250 ml starting volume

Pressure Gauge Valve Sample Solution Hollow Fiber

Permeate

2 filtration steps prior to concentration 50 to 100% recovery test milk, vegetables

3

11/14/2007

Processing of Stomached Hot Dog

250 200

Volume (ml)

Pressure, Permeate Volume vs. Time 220 mL Stomached Hot Dog Processed

100 90 80 60 50 100 50 0 10 30 50 70 90 110

Time (min)

P Pressure (psi)

70 150

40 30 20 10 0 130 150 170 190 210

Volume Pressure

Stomached Hot dog

Homogenized Hot Dog

Permeate

Concentrate

Initial Cell Concentration (cells/mL) Liu et al, 2007 190 % Cell change (cells/mL) 13 x 103

Pressure (PSI) 25-29

Leakage 0.0

Recovery viable cells 610

Total Captured Cells 53 x 103

% recovered E. Coli 114

Cross flow hollow fiber

Able to process 250 mL or more Homogenized hot dog Dry milk Vegetables (leafy matter) Mechanisms being studied Testing being carried out

McKinnis, Rodriguez et al, 2007

SEM Photos of Membrane Fouling: with Baby Formula (contains fat)

wide angle view: g axial cut membrane

(765)742-9066 (765)742 9066

Inner surface of clean membrane

Inner surface after filtering baby formula

Inner Surface

external surface after filtering formula.

Axial cut of clean membrane.

axial view after filtering formula.

McKinnis, 2007

Stainless Steel Membrane

Summary on Cell Concentration

· Stainless Steel Construction · Smooth Inner Surface · Low Adhesion · High Chemical Resistance · Small Pore Size 0. 1µm Cell Concentration and recovery should result in 1000 To 10,000 Cells / mL CCR for a single large volume is preferred over replicates of smaller proportions of the same volume Cross flow membranes are able to process homogenized or stomached samples that block flat membranes

4

11/14/2007

Goal: to investigate if mammalian cell receptor can be used as a capture molecule for biosensor application

Mammalian cell receptor for capture of pathogens on sensor surface

o LAP (~94 kDa), a membrane bound alcohol acetaldehyde dehydrogenase enzyme responsible for adhesion to mammalian cells o Bi-functional protein: (i) Enzyme (ii) Adhesion o N-terminal part is ALDH (acetaldehyde dehydrogenase) o C-terminal end is ADH (alcohol dehydrogenase) o Interacts with eukaryotic Hsp60 (chaperone protein) o Hsp60 is present on mammalian cell surface

LAP

Hsp60

Stereographical Representation of the Molecular Surface of the Complex LAP and Hsp60

LAP

Hsp60 (receptor) immobilization

Bacteria LAP Bioreceptor Biotin Biotinylated Hsp60 Streptavidin St t idi Biotinylated BSA

Sensor surface

Ribbon model LAP Hsp60

Hsp60

KD = 1.68 X 10-8 M

Surface topography

D. La, D. Kihara, B. Jagadeesan and A. Bhunia - Unpublished

Silicon dioxide chips with microfluidic set up

Comparison of MAb C11E9 and Hsp60-mediated capture of L. monocytogenes cells on silicon dioxide surface

Net binding (c counts/area) cell

100.00 90.00 80.00 70.00 60.00 50.00 40.00 40 00 30.00 20.00 10.00 0.00

Inoculation concentration = 5 X 107 CFU/well

65.56

PDMS Well area=23.039 mm2

0.69

Bacteria added: 5x107 cfu/well Incubate for 2 h at RT Wash and stain with propidium iodide Count under microscope (area: 130 x 98 m)

Koo et al (unpublished)

C11E9

Receptor Hsp60 MAb C11E9 NET binding (Cell number/image) 65.56 ± 25.94 0.69 ± 13.16

Hsp60

Estimated total cell numbers/well 1.19E+05 ± 4.69E+04 1.25E+03 ± 2.38E+04

Koo et al (unpublished)

5

11/14/2007

E-cadherin (InlA)-mediated capture of L. monocytogenes cells in microtiter plate

3.5 3 Abosrba ance (OD490 2.5 2 1.5 15 1 0.5 0

Hsp60 E-cadherin

Schubert et al. 2002. Cell 111:825

Specificity of Hsp60 in capturing Listeria cells with Hsp60 coated SiO2 surface

NET Binding (Cell Number)

160 140 120 100 80 60 40 20 0

L. iv an ov ii L. in no cu a L. w el sh im er i L. se el ig er i KB 20 8 L. gr ay i Lm (la p)

w receptor w/o receptor

initial numbers added 5x107 CFU/well

Lm counts with receptor Hsp60 E-cadherin 2.699±0.175 0.463 ± 0.092

Lm counts without receptor 0.764 ± 0.130 0.427 ± 0.058

Koo et al (unpublished)

Koo et al (unpublished)

Captured Listeria cells on Hsp60 coated SiO2 chip

Bacteria

Hsp60 mediated capture profile of Listeria cells on SiO2 surface

NET binding (counts/imagea) 110.93 ± 26.29 79.46 ± 60.11 4.92 ± 3.44 1.92 ± 4.27 4.72 ± 2.96 2.52 ± 3.12 12 ± 6.25 Initial CFU/well 5.80E+07 4.10E+07 3.30E+07 2.20E+07 3.30E+07 2.50E+07 4.40E+07 Estimated total cells/well 2.01E+05 ± 4.75E+04 1.44E+05 ± 1.09E+05 8.89E+03 ± 6.22E+03 3.46E+03 ± 7.71E+03 8.52E+03 ± 5.35E+03 4.55E+03 ± 5.65E+03 2.17E+04 ± 1.13E+04

L. m on oc yt og en es

% Capture

0.401 ± 0.095 0.287 ± 0.217 0.018 ± 0.012 0.007 ± 0.015 0.017 ± 0.011 0.009 ± 0.011 0.043 ± 0.023

L. monocytogenes L. ivanovii L. monocytogenes (185) L. ivanovii (195) L. innocua (15) L. Innocua L. welshimeri L. seeligeri L. grayi Lm KB208 (lap-)

a

The area for each image was 130 x 98m.

L. welshimeri (12)

Koo et al (unpublished)

L. seeligeri (7)

L. grayi (6)

Koo et al (unpublished)

Surface LAP expression

LAP expression assay

Cy5

Anti-LAP MAb LAP

% Positive cells (out of 105 cells)

Hsp60 binding assay

HRP

Anti-Hsp60 MAb Hsp60 LAP

0.9 0.8 0.7 0.6 06 0.5 0.4 0.3 0.2

Capture profile of various food-associated microorganisms on Hsp60-coated SiO2 surface (Selectivity)

160.00 140.00

6 5 4 3 2 1 0

EM10 MAb

Secondary only

NET Binding (C Numbe Cell

120.00 100.00 80.00 60.00 40.00 20.00

Abs490

LM: L. monocytogenes, StA: Staphylococcus aureus, SalE: Salmonella Enteritidis, EC: Escherichia coli O157:H7, BC: Bacillus cereus, BS: B. subtillits, PV: Proteus vulgaris, EA: Enterobacter aerogenes, StE: Sta. epidermis PA: Pseudomonas aeruginosa, SeM: Serretia marcensens, CF: Citrobacter freundii, HA: Hafnia alvei, LR: Lactobacillus rhamnosus, LC: Lb.casei, LeuM: Leuconostoc mesenteroides L M L t t id

KB208 (lap-)

0.1 0

L. seeligeri

L. welshim

L. innocua

Lm F4244

L. ivanovii

L. grayi

0.00

LM StA SalE EC BC BS PV EA StE PA SeM CF HA LR LC LeuM

Flow cytometry

Burkholder et al unpublished

Microtiter plate assay

(Inoculation concentration was ~107 CFU/well)

6

11/14/2007

Estimation of limit of detection (sensitivity) for Hsp60 using biochip and ELIFA (inset)

450 400 350

Selective capture of L. monocytogenes in the presence of other bacteria by Hsp60 on Chip

LM 1 1 1 0 SE 1 1 0 1 EC 1 0 1 1 Total Counts 15.42 ± 12.95 18.9 ± 11.8 17.2 ± 11.13 5.8 1.48 5 8 ± 1 48 % capture (LM) 56.56 62.37 65.25 -LM Counts 11.33 ± 10.3 11 ± 6.29 13.2 ± 10.86 % capture (LM) 73.48 58.2 76.74

SiO2

0.250

0.200 V Vmax (units per sec

ELIFA

NET Binding B

0.150

300 250

Indirect Direct Direct-mix

0.100

200 150 100 50 0

5.00E+07 5.00E+06

0.050

0.000

5.00E+07 5.00E+06 5.00E+05 5.00E+04 5.00E+03 5.00E+02

LM 1 1

K-12 1 1 0 1

LbA 1 0 1 1

Total Counts 18 ± 7.38 18.6 ± 6.36 14.1 ± 4.01 12 ± 5.93

LM Counts 10.18 ± 6.66 11.6 ± 5.27 9.2 ± 3.77 --

CFU

5.00E+05

5.00E+04

5.00E+03

5.00E+02

1 0

Listeria monocytogenes

ELIFA: enzyme: alkaline phosphatase, substrate: 4-methylumbelliferyl phosphate (MUP); measurement (Ex/Em): 360/440nm

LM: L. monocytogenes, SE: Sal. Enteritidis, EC: E. coli O157:H7; K-12: E. coli K-12, LbA: Lb. acidophilus

Hsp60 coated fiber

Application of Hsp60 for capture of Listeria on optical waveguide (Fiber Optic)

Cell Numbe

C11E9 coated fiber

Confocal microscopy

160 140 120 100 80 60 40 20 0

Cell counts/image

Hsp60 C11E9 92.00 ± 46.56

A

Total estimated cell number/Fiber

1.71E+05 ± 8.64E+04 8.04E+04 ± 2.90E+04

43.33 ± 15.62B

C11E9

Hsp60

Next steps with Hsp60

· Determine capture efficiency on microfluidic chip with or without DEP · Determine capture efficiency on SPR · Determine capture efficiency with magnetic beads · AFM to examine the binding strength/patterns · Determine the interaction domains for LAP and Hsp60

Microfluidics device design for pathogen detection: systems integration of biochip functions

7

11/14/2007

Overview of Biochip-based Detection Process

100-250ml fluid 100ul fluid (w. cells) Biochip sensor Readout

Outline

1. Brief review of prior work 2. PCR in the "Petri Dish on a Chip"

a. Optical Detection b. Label-Free b Label Free Electrical Detection

Sample

· · · · Water Food Air Body Fluids

Off-chip Concentration

Detection/ ID

Data Analysis/ Results

Sample 100 ­ 250 ml

3. Future Work

On-Chip Concentration 1000X Electrical Detection of cell Growth Electronic Biomolecular identification

Automated Off-Chip Cell Concentration And Recovery - 1000X

~ 15 - 30 min

~ 30 min

~ 1- 3 hr

~ 1- 3 hr

Integrated BioChips for Study of Microorganisms and Cells

Lab-on-a-chip for Detection of Live Bacteria

Liu, Park, Li, Huang, Geng, Bhunia, Ladisch, Bashir

Outline of "PCR in Petri Dish" Current Work

Nanopore Sensors for DNA Detection

Chang, Andreadakis, Kosari, Vasmatzis, Bashir

Fluidic Ports

On-chip AbMicro-scale Nano Dielectro- based Impedance -probe phoresis Capture Spectroscopy Array

Cantilevers, NanoFETs, Nano-pores

· PCR reaction with a 508 bp Listeria monocytogenes prfA gene. · Calibration of the thin film temperature sensor on chip using LabView data acquisition.

700µ Pin m

Glass cover

In/Out ports

Cavities/ Wells

Epoxy adhesive

Dielectrophoresis Filters an Traps for Biological Entities

Li, Akin, Bhunia, Bashir

Conc. Sorting

Selective Capture

Growth Detection

Cell Lysing

Mech/Elect. Detection DNA, protein

Silicon Nanowires and Nanoplates for DNA and Protein Detection

Elibol, Reddy, Nair, Bergstrom, Alam, Bsahir

· Design and realization of automatic thermal cycling on chip at low average power values. · Development of a real time PCR protocol for Listeria monocytogenes on chip · Direct electrical detection of PCR products

Trapping/Lysing of Bacteria/Viruses In Microfluidic Devices

Park, Akin, Bashir

Nano-Mechanical Cantilever Sensors for Detection of Viruses

Gupta, Akin, Broyles, Ladisch, Bashir

Micro-Mechanical Cantilevers for Detection of Spores

Davila, Walter, Aronson, Bashir

"Lab on a Chip" with microfluidics and micro/nanosensors

On Chip PCR

System and PCR Details

Digital multi-meter for sensing output signal from the PMT Gain voltage for amplifier in PMT module

Dual pole power supply for bias voltage to PMT

Photo multiplier tube module

Gold-plated Heater bond pads

Top Al Support Glass Cover Biochip PCB Bottom Al Support Peltier Cooler Septum Layer

Temp Sensor

Fluid only (low flow, no particles) Deviation Outlet DEP electrodes Fluid and Particles (w. Abs and (low flow) growth detection) Main Outlet

Edge Connector

Fluid and particles (large flow) Fluid only (large flow, no particles)

· Integration of a PMT (photomultiplier tube) module for fluorescence detection · 0.5µl/min flow rate at a 20Vpp DEP voltage with frequency 100 KHz in LCGM · PCR reagents introduced, cells lysed at 95C, and PCR cycling initiated

­ SYBR Green based PCR Assay ­ prfA 508 bp segment target for specfic detection of LM ­ 5'CGGGATAAAACCAAAACAATTT3' and R5'TGAGCTATGTGCGATGCCACTT3' Bhattacharya, et al. 2007, Submitted

R. Gomez, D. Morisette, R. Bashir, IEEE/ASME JMEMS, 2005

Inlet

DEP deviation electrodes

8

11/14/2007

PCR Thermal Cycling

100

100

T= 94 deg. C

61secs

Calibration of signal acquisition using SYBR green based PCR mix

0.40 0.35

80

Temperature (Deg. C)

Temperature (Deg. C)

80

T= 72 deg. C

60

60

.5ng/ microliters at 10cycles .5ng/ microliters at 20cycles .5ng/ microliters at 30cycles .5ng/ microliters at 35cycles

0.45 0.40 0.35 0.30

5ng/ microliters afer 10 cycles 5ng/ microliters afer 20 cycles 5ng/ microliters afer 30 cycles 5ng/ microliters afer 35 cycles

T= 55 deg. C

60secs

PMT voltage (V)

0.30 0.25

PMT voltage (v)

40

40

0.25 0.20 0.15 0.10 0.05 0.00 -0.05

20 0

Signal plot for the onchip thermal cycle

2000 4000 6000 8000 10000 12000

64secs 6secs 7secs

4100 4200

0.20 0.15 0.10 0.05

64secs

20 4000

4300

4400

4500

0.00 -0 05 0.05

T im e (secs) ( )

Signal plot for active cooling (B) Signal plot for passive cooling(A)

Time (secs)

5

10

15

20

25

30

35

5

10

15

20

25

30

35

Time (secs)

Time (secs)

100 Temperature (deg. C) 80 60 40 20 0 2000

0.70 0.65 0.60 0.55 0.50

Average PMT Readout from first 3secs of aquisition

Temperature plots of passive versus active cooling

1.7 °C/sec

2200 2400 Time (secs)

5.1 °C/sec

2600 2800

· Average power 2.5 W · Total time 112 min for active cooling · Times at each temperature can be reduced

Bhattacharya, et al. 2007, Submitted

50ng/ microliter after 10 cycles 50ng/ microliter after 20cycles 50ng/ microliter after 30 cycles 50ng/ microliter after 35 cycles

0.65 0.60 0.55 0.50 0.45 0.40 0.35 0.30 0.25 0.20 0.15 0.10 10

.5ng/ microliter initial template 5ng/ microliter initial template 50ng/ mircoliter initial template

PMT Volatage (V)

0.45 0.40 0.35 0.30 0.25 0.20 0.15 0.10 0.05 0.00 -0.05 5 10 15 20 25 30

15

20

25

30

35

Time (secs)

# of cycles

End Point PCR Detection Sensitivity

8 7 6 5 4 3 2 1 0 28% increase 177% increase 503% increase 448% increase

5

Specificity Trials Without DEP

220% increase

339% increase

2

Trial # Sample details

Pre PCR

1 1

167% increase

Normal lized Fluorescence Values from PMT

Norm malized Fluorescence Values from PMT

109% increase

4

109% increase

Post PCR

1.16 2.67

%

incre ase

Normalized Fluorescence Values d f from PMT

2.5

3 1

16.5% increase 63.35% increase

4

47.05% increase

3

2.0

1

2

Listeria Innocua + E. coli (control) 108 cells/ml (Listeria Innocua + E. coli + Listeria Monocytogenes V7) 107 cells/ml (Listeria Innocua + E. coli + Listeria Monocytogenes V7) 106 cells/ml (Listeria Innocua + E. coli + Listeria Monocytogenes V7)

16 167

1.5

2

1 0

1.0

with DEP 105 cells/ml post PCR

with DEP 105 cells/ml pre PCR

105 cells/ml post PCR

105 cells/ml pre PCR

with DEP 104 cells/ml post PCR

with DEP 104 cells/ml pre PCR

3 4

1

1.63

63

0.5

107 cells/ml postPCR

105 cells/ml post PCR

108 cells/ml postPCR

106 cells/ml postPCR

105 cells/ml pre PCR

108 cells/ml prePCR

107 cells/ml prePCR

NTC Post PCR

106 cells/ml prePCR

NTC pre PCR

0.0

Post PCR Template 1 Post PCR Template 2 Pre PCR Template 1 Pre PCR Template 2 Pre PCR Template 3 Post PCR Template 3 Post PCR Control Pre PCR Control

1

1.47

47

Pre and post PCR summary for various cell concentrations without DEP concentration. 105 cells/ml, 0.5ul/min for 1.2min, 60 cells

Pre and post PCR summary for various cell concentrations with DEP concentration. 104 cells/ml, 0.5ul/min for 12min, 60 cells ! Bhattacharya, et al. 2007, Submitted

0.5ul/min for 1.2min, 600 cells 106 cells/ml

Towards Label Free Electrical Detection of PCR Products

· Polymerase Chain Reaction

­ Target molecule doubles every cycle

Cycle # 1 2 3 4 5 10 20 30 40 # of Molecules 2 4 8 16 32 1024 (103) 1048576 (106) 1073741824 (109) 1099511627776 (1012) 103 #/ul 106 #/ul 109 #/ul 1012 #/ul Conc. (#/ul)

Electrical Nature of DNA Molecules

Positive counter ions Positive counter ions

Z

Negative charged dsDNA backbone

Negative charged dsDNA backbone

Before applying electrical field

Induced dipole when DNA molecules are probed electrically in solution ·DNA polarization (dipole effect) ·Dielectric relaxation (Debye relaxation) :

= +

Eeffective=E - Epolarization= k 0

1 + j

Cap.

with L(or #) Z Rsol Z

· What is the minimum concentration of dsDNA molecules (e.g. 500bp) that can be directly detected in solution using impedance measurements ???

Cap.=

k 0 A d

·Counter Ion movement:

9

11/14/2007

Dielectric Relaxation of DNA in Solution

the migration of counter ions over the entire dimension of the DNA molecule Local changes of Counter-ions around the phosphate ions Reorientation of water molecules around the DNA

Proof of Concept Experiments

Top View Side View

' ''

-4 -3 -2

relaxation relaxation relaxation

Experiment set-up, side and topview of device. (Measurement equipments include a LCR meter (Agilent 4284A), a data acquisition system (Agilent 34905A), micromanipulators (Micromanipulator M450, M-550), a computer with selfdeveloped labview control software.)

PDMS well

-1

0

1

2

3

4

5

6

7

8

9

10

Log Frequency

(ref: "Electrical Properties and Dielectric Relaxation of DNA in Solution", James BakerJarvis, Chriss A. Jones, Bill Riddle, NIST Technical Note 1509, 1998.)

PDMS well Interdigitated Electrodes

Label free DNA detection in DI water

500 bp dsDNA

105 108#/µl; + DI Control

105

Circuit Model and Parameter Extraction

109 #/µl dsDNA

Electrolyte

DI Control 100 bp 500 bp 103 1000 bp

Z

Zdl Rser

105

Cdi Rsol Zdl

Z (ohm)

1010#/µl 1011#/µl

103

Z (ohm)

104

109#/µl

104

Electrode

102

103

104

105

102

103

104

Frequency (Hz)

Frequency (Hz)

Cdi

increases with # or L, C increases, Z decreases

Detection limit in DI Water for 500bp DNA = 1e9 #/l (1.33 nM)

DNA prepared by QIAquick Gel Extraction Kit, QIAGEN, Valencia, CA Rser Zdl Rsol Zdl

Selectivity Measurements Label free DNA detection in PCR Solution

1.35E+03 1.30E+03

Listeria monocytogenes

2.70E+03

Listeria monocytogenes

2.65E+03 2.60E+03

30 cycles

30 cycles

Cdi (pF)

30 cycles

Extracted Solution Conductance

S - 0 cycle 2.50E-02 2.45E-02 2.40E-02 S - 30 cycles C - 0 cycle C - 30 cycles

Extracted Solution Capacitance

S - 0 cycle 2.30E+04 2.20E+04 S - 30 cycles

Cdi (pF)

2.55E+03 2.50E+03 2.45E+03 2.40E+03 2.35E+03 2.30E+03

1.25E+03

Sample

Control

Cdi (pF)

Sample

C - 0 cycle

Control

C - 30 cycles

1.20E+03

0 cycle

0 cycle

0 cycle

1.15E+03

1/Rsol (mho os)

2.35E-02 2 35E 02 2.30E-02 2.25E-02 2.20E-02

1.10E+03

2.25E+03

2.10E+04 2.00E+04

30 Cycle

30 Cycle

30 Cycle

30 Cycle

0 Cycle

0 Cycle

0 Cycle

2.15E-02 2.10E-02 2.05E-02 2.00E-02

0 Cycle

1.90E+04 1.80E+04 1.70E+04

3.70E+03 3.60E+03

E. coli

12 10 8 6 4

Cdi % Change between PCR 0 cycle & 30 cycles

Listeria monocytogenes

Cdi (pF)

3.50E+03 3.40E+03 3.30E+03 3.20E+03 3.10E+03

sample (PCR mix plus DNA template) control (PCR mix only) 1 g starting concentration (3e8 bacterial cells)

0 cycle

30 cycles

% Change

2 0

E. coli

1 g starting concentration (3e8 bacterial cells)

10

11/14/2007

Selectivity Experiment Summary (L. m. & E. coli):

· 10 - 12 % increase in Cdi with L. m. template and L. m. prfA gene primer. · 0.5 % increase in Cdi with E. coli template and L. m. prfA gene primer. · If primer-dimers formed, the increase in Cdi is about 9% in Cdi.

· We have to avoid primer-dimers and unspecific amplifications ! · The detection is real, i.e. Cdi will change whenever there are significant DNA molecules.

Detection Limits

· We used 1 g of initial genomic DNA 3e8 bacterial cells (we used 25µl solution) ~1e7 #/µl in PCR mix · 1e7 #/µl · 1e7 #/µl after 30 cycle PCR 1e16 #/µl #/µ 1e4 #/nl before 30 cycle PCR

E. coli without primer-dimer

3.70E+03 3.60E+03 3.50E+03 3.40E+03 3.30E+03 3.20E+03 3.10E+03 1.60E+03

E coli with primer-dimer

30 cycles

1.55E+03

· Use 1000 cells in 0.1nl · Mechanical Filter · On-Chip PCR and direct electrical detection

Mechanical slit filter

Cdi (pF)

Cdi (pF)

1.50E+03

1.45E+03

0 cycle

0 cycle

30 cycles

1.40E+03

1.35E+03

Heat Lysing

Next Steps

· Optimize real time PCR with fluorescence detection for reduced time

­ Also demonstrate for Escherichia coli (in progress) and Salmonella

Isothermal RNA Amplification

· Promoter primer binds to rRNA target. · Reverse transcriptase creates a DNA copy of the rRNA target. · The RNA - DNA duplex. · RNAse H activity of the reverse transcriptase degrades the rRNA. · Primer 2 binds to the DNA and reverse transcriptase creates a new DNA copy. · Double stranded DNA template with a promoter sequence.

(figure from the Gen-Probe Inc)

· On-chip label-free electrical detection of PCR product in microfluidic device · Move to RNA detection so as to

­ lower the limit of detection ­ have the possibility of live/deal information about Bacterium.

· Isothermal RNA (TMA) fluorescence detection off and on chip · Isothermal RNA amplification (TMA) electrical detection on chip

­ To obviate the need for thermal cycling requirement ­ To eliminate time loss in ramp up/down

Isothermal RNA Amplification

· RNA polymerase initiates transcription of RNA from the DNA template. · 100 to 1000 copies of RNA amplicon are produced. · Promoter primer binds to each RNA amplicon and reverse transcriptase creates a DNA copy. · RNA - DNA duplex. · RNase H activity of the reverse transcriptase degrades the rRNA.

Final Conclusions

· Cell concentration and recovery using large volumes demonstrated · Processing of complex samples (baby milk, vegetables) begun · Very promising receptor (hsp-60) identified for capture of Listeria monocytogenes · Capture demonstrated on biochips and fiber optic biosensor · PCR on a Chip with fluorescence detection of 60 cells · Label-free electrical detection of PCR product on chip initiated

(figure from the Gen-Probe Inc)

11

Information

Microsoft PowerPoint - biochip.ppt [Compatibility Mode]

11 pages

Report File (DMCA)

Our content is added by our users. We aim to remove reported files within 1 working day. Please use this link to notify us:

Report this file as copyright or inappropriate

116828