Read ABSTRAK-2008.pdf text version

001 Muslihati; Moh. Bisri. 2007. Profil Skripsi Mahasiswa Jurusan BKP Tahun 2004-2006

Kata-kata kunci: skripsi, jurusan BKP

Skripsi merupakan karya ilmiah yang ditulis oleh mahasiswa program sarjana pada akhir masa studinya berdasarkan hasil penelitian, kajian kepustakaan, atau pengembangan suatu masalah yang dilakukan dengan seksama.Tujuan peneltiian ini memberi pengalaman belajar kepada mahasiswa program sarjana dalam memecahkan masalah secara ilmiah dengan cara melakukan penelitian sendiri, menganalisis dan menarik kesimpulan, serta menyusun laporan penelitian. Sebagai bagian dari pengembangan kompetensi maka topik skripsi mahasiswa harus memperhatikan rumpun ilmu di jurusan tersebut. Mahasiswa Jurusan BKP diharuskan mengembangkan topik skripsi berdasarkan rumpun ilmu psikologi pendidikan khususnya seputar bimbingan dan konseling di sekolah. Konsentrasi kajian jurusan BKP diantaranya manajemen dan administrasi BK di sekolah, konsep-konsep utama perilaku manusia dan hubungan antar konsep, konseling multi budaya dan pengembangan program bantuan bagi siswa. Tujuan utama dari penelitian ini adalah melakukan pemetaan hasilhasil penelitian skripsi mahasiswa jurusan BKP tahun 2004-2006 yang tertuang dalam data base laboratorium jurusan BKP berdasarkan bidang kajian bimbingan dan konseling yang sudah diteliti mahasiswa jurusan BKP tahun 2004-2006 dan metode penelitian yang digunakan peneliti skripsi Hasil penelitian menunjukkan bahwa terdapat 161 topik skripsi prodi BK jurusan BKP yang diarsip oleh laboratorium BKP. Berdasarkan kategori bidang bimbingan, topik skripsi mahasiswa mayoritas termasuk dalam kategori bidang bimbingan pribadi (24.07%) dan kajian bimbingan pribadi yang dikaji secara integratif dengan bidang bimbingan sosial (23.45%). Metode penelitian yang banyak digunakan adalah metode penelitian dengan pendekatan kuantitatif yaitu sejumlah 150 topik (92%) dan masih sangat sedikit yang menggunakan metode eksperimen dan pengembangan. Sebaran konsep yang dikaji sebagian besar berada dalam ranah afektif yaitu 72%, sementara manajemen dan organisasi BK belum banyak dikaji dalam skripsi mahasiswa.

1

2

Abstrak Hasil Penelitian

002 Soepriyanto, Yerry; Adi, Eka Pramono; Praherdhiono, Henry. 2007. Penerapan Teknologi Content Management System pada Platform Open Source Untuk Optimalisasi Layanan Perkuliahan dan Pengembangan Model Pembelajaran Matakuliah Jurusan TEP

Kat-kata kunci: TEP, statistik, jaringan, model pembelajaran

Kondisi perkuliahan secara umum pada proses pembelajaran dijurusan tekhnologi pendidikan (TEP) fakultas ilmu pendidikan Universitas Negeri Malang ( UM ) menggunakan penyajian informasi tatap muka secara langsung dengan model verbal. 50% dosen telah menggunakan perangkat komputer personal sebagai media pembelajaran. Kebijakan jurusan pada laboratorium tekhnologi pendidikan nantinya akan diwujudkan sarana sistem jaringan (LAN) dan web-site (www.Tep.com). Kondisi sekarang,baik desain jaringan dan satuan tugasbelum dapat diimplementasikan. Sehingga fasilitas-fasilitas komputer personal yang berada pada laboratorium belum dimanfaatkan secara maksimal. Hal ini lebih dikarenakan karenakan minimnya kegiatan yang mengarah pada pembelajaran dengan sistem Distance Learning. Penelitian ini bertujuan untuk memfasilitasi komunikasi dan interaksi antara siswa dengan guru/narasumber, meningkatkan kolaborasi antar siswa untuk membentuk komunitas belajar. Masalah untuk memperoleh pembelajaran yang bermakna. Mendorong siswa untuk secara mandiri mencari sumber belajar dan mencapai makna. Siswa akan termotifasi untuk secara mandiri mencari berbagai sumber belajar dan mencapai kebermaknaan dari proses pencariannya, memberikan umpan balik lintas ruang dan waktu. Memberika akses kepada beragam sumber belajar terhadap mata kuliah statistik. Desain jaringan yang dikembangkan adalah Learning and Content Management system pada jaringan yang menggabungkan dua platform yang berbeda yaitu open source linux dan open mind microsoft. Pengembangan jaringan secara hardware menggunakan jaringan dengan kabel jaringan untuk jaringan dengan sifat statis dan menggunakan Wi-Fi untuk sifat penggunaan mobile, media pembelajaran berupa Web yang memiliki karakteristik Web dinamis, sehingga web ini dapat diakses melalui sistem level akses. Hasil validasi tergambarkan bahwasanya sistem jaringan pada tahap pengembangan dapat memberikan kontribusi model pembelajaran dan dapat direspon positif oleh mahasiswa.

Edisi ke-27 Tahun 2008

3

003 Sunandar, Asep; Sunarni; Sumarsono, R. Bambang. 2007. Pengaruh Motivasi Kerja Guru dan Gaya Kepemimpinan terhadap Efektivitas Manajemen Kelas (Studi Kasus di SMA Lab. School UM)

Kata-kata kunci: manajemen kelas, motivasi kerja, gaya kepemimpinan

Manajemen kelas pada umumnya kurang diperhatikan oleh guru, banyak kasus yang mengemuka kehadiran guru di kelas hanyalah sebatas mengugurkan kewajiban, mereka kurang begitu memperhatikan kebutuhan dan kenyamana siswa dalam belajar. Penelitian ini mencoba untuk menggali faktor utama yang menentukan keefektifan manajemen kelas yang dilakukan guru. Metode penelitian yang digunakan adalah pendekatan kuantitatif dengan teknik statistik deskriptif korelasional. Faktor motivasi kerja guru memiliki angka korelasi yang sangat besar yaitu 0,800 gaya kepemimpinan diperoleh koefisien korelasi sebesar 0,712 dan determinasi diantara kedua variabel dependent terhadap variabel independent adalah sebesar 84,1%. Berdasarkan hasil penelitian, ternyata kedua faktor tersebut memiliki korelasi positif terhadap terciptanya efektivitas manajemen kelas. Para guru, kepala sekolah dan pengambil kebijakan Dinas Pendidikan hendaknya memperhatikan kedua faktor tersebut agar kualitas pembelajaran dapat ditingkatan. 004 Mahliatussikah, Hanik; Ridwan, Nur Anisah. 2007. Citra Wanita Arab dalam Antologi Cerpen Al-Arwah Al-Mutamarridah Karya Khalil Gibran

Kata-kata kunci: citra wanita, al-arwah al-mutamarridah, gibran khalil gibran

Citra wanita dalam karya sastra dan pencitraan wanita oleh pengarang, tidak hanya dapat dilihat dari karya-karya pengarang wanita dan tokoh feminis wanita, tetapi juga dapat dilihat dari karya-karya pengarang laki-laki. Kritik sastra feminis tidak membedakan pengarang wanita dan pengarang pria. Yang penting, dalam karya itu terdapat tokoh wanita, baik yang berperan sebagai tokoh utama maupun tokoh tambahan. Berdasarkan teori itulah, peneliti akan mengungkap citra wanita Arab dalam antologi cerpen Al-arwâh Al-Mutamarridah karya Gibran khalil Gibran. Antologi cerpen ini termasuk salah satu karya monumental Gibran. Sebagai karya unggulan, kepopuleran karya ini dibuktikan dengan adanya penerjemahan ke dalam bahasa Indonesia dan bahasa Inggris serta ulasan-ulasan dalam media massa dan elektronik. Urgensi karya Gibran bagi masyarakat ini juga ditunjukkan oleh Mikhail Na`imah, seorang sastrawan dan kritikus Arab yang

4

Abstrak Hasil Penelitian

berupaya mengumpulkan seluruh karya-karya Gibran berbahasa Arab dengan judul Al-Majmuah Al-Kamilah limu`allafati Jubran Khalil Jubran. Penelitian ini bertujuan untuk menemukan dan mendeskripsikan citra wanita Arab dalam antologi cerpen Al-Arwah Al-Mutamarridah karya Gibran Khalil Gibran. Pembahasannya meliputi: (1) pemaparan peran, fungsi, dan kedudukan perempuan Arab dalam antologi cerpen Al-Arwah Al-Mutamarridah karya Gibran Khalil Gibran, (2) pendeskripsian wujud gambaran mental spiritual dan tingkah laku yang terekspresikan oleh perempuan Arab, (3) penjelasan bagaimana Gibran Khalil Gibran sebagai seorang sastrawan Arab yang populer tingkat internasional itu mencitrakan perempuan Arab dalam antologi cerpennya, (4) pendeskripsian nilai-nilai yang muncul dalam antologi cerpen Âl-arwâh Al-Mutamarridah, (5) penjajakan apakah Gibran Khalil Gibran mencitrakan perempuan dalam antologi cerpennya dengan pencitraan yang sama antara satu cerpen dengan cerpen yang lain ataukah memiliki cara pandang yang berbeda. Penelitian ini menggunakan rancangan deskriptif kualitatif. Data penelitian berupa teks Al-arwah Al-Mutamarridah karya Gibran Khalil Gibran yang mengungkap citra wanita Arab. Data ini diambil dari sumber data yang berupa antologi cerpen Al-Arwah Al-Mutamarridah yang berisi 4 cerpen, yaitu Wardah al-Haniy, Shurakhul qubur, madhjaul ,,arus, dan Khalil al-Kafir. Hasil penelitian menunjukkan bahwa perempuan Arab (Libanon) dalam antologi cerpen Al-arwah Al-Mutamarridah karya Gibran Khalil Gibran memiliki peran, fungsi, dan kedudukan, baik dalam lingkungan keluarga maupun dalam lingkungan sosial. Dominasi peran, fungsi, dan kedudukan perempuan adalah dalam lingkungan keluarga, yaitu sebagai ibu yang memberi nasehat, menyayangi, dan memperhatikan anaknya; sebagai istri, dan sebagai anak. Dalam hal jodoh, ayah memiliki otoritas penuh terhadap anak perempuan. Anak perempuan tidak mendapatkan kebahagiaan dari perjodohan tersebut karena jiwanya terkekang dan terpenjara oleh terali adat. Adapun dalam lingkungan sosial, perempuan memiliki peran, fungsi, dan kedudukan yang terbatas sebagai pendukung kaum laki-laki, berada dalam kekuasaan lakilaki, dinomorduakan dalam berpendapat maupun dalam pengambilan hukum. Perempuan berada dalam posisi yang dirugikan penguasa. Peran, fungsi, dan kedudukan perempuan dalam lingkungan keluarga dan sosial tersebut berpengaruh terhadap wujud mental spiritual dan tingkah laku yang terekspresikan oleh perempuan Arab. Dalam antologi cerpen Âlarwâh Al-Mutamarridah, perempuan Arab memiliki watak pemberani dalam rangka memperoleh kebebasan jiwanya, setia pada kekasih, penyayang, tabah, tegar, tawakkal, memiliki pendirian yang kuat, ingin dihargai sebagaimana laki-laki, tidak ingin dikekang dan ditindas.

Edisi ke-27 Tahun 2008

5

Sebagai seorang sastrawan Arab yang populer tingkat internasional, Gibran mencitrakan perempuan Arab dalam antologi cerpennya dengan pencitraan yang positip dan setara dengan laki-laki. Perempuan adalah sosok manusia yang memiliki rasa cinta, punya harga diri, dan punya hak berpendapat. Ketenangan batin dan kebebasan jiwanya tidak dapat dibeli dengan harta dan kemewahan. Nilai-nilai yang muncul dalam antologi cerpen Al-arwah Al-Mutamarridah berpusat pada kebebasan jiwa yang diperjuangkan sampai titik darah penghabisan. Kebahagiaan hanya akan dicapai melalui pembebasan jiwa. Gibran mencitrakan perempuan dalam antologi cerpen Al-arwah AlMutamarridah dengan pencitraan yang sama antara satu cerpen dengan cerpen yang lainnya, yaitu dengan pencitraan yang positip terhadap perempuan Arab. Perempuan adalah mitra laki-laki dalam berbagai aktivitas kehidupan. 005 Syahri, Mochammad; Karkono. 2007. Analisis Framing Berita Poligami di Media Massa

Kata-kata kunci: poligami, Framing, Media

Penelitian ini bertujuan untuk melihat framing berita poligami dimedia massa. Yang menjadi objek kajian adalah berita-berita poligam di majalah Hidayatullah versi on-line. Penelitian ini menggunakan pendekatan analisi framing. Inti dari metode analisis framing adalah bagaiaman sebuah berita diberi makna dan dibingkai oleh media massa. Hasil penelitian menunjukkan bahwa majalah Hidayatullah secara konsisten mendukung ide-ide poligami. Dari berita-berita yang dimuat, majalah Hidayatullah memerankan diri sebagai pembela atas orang-orang yang melakukan poligami. 006 Samodra, Joko; Yunus, Mahmuddin; Susilo, Gunawan. 2007. Perancangan Multimedia Interaktif Pembelajaran Videografi bagi Pemula

Kata-kata kunci: videografi, multimedia, pembelajaran

Videografi merupakan keterampilan dasar yang harus dimiliki oleh pemula yang ingin belajar video. Buku petunjuk dan tutorial tentang videografi dewasa ini telah banyak beredar, namun masih diperlukan media lainnya yaitu berbentuk multimedia interaktif. Teknologi multimedia komputer mempunyai peranan semakin penting dalam pembelajaran karena multi-

6

Abstrak Hasil Penelitian

media akan dapat membawa situasi belajar dimana "Learning with effort" akan digantikan dengan "Learning with fun". Beberapa penelitian juga menunjukkan adanya pengaruh positif dipergunakannya multimedia dalam proses pembelajaran. Penelitian ini bertujuan untuk merancang dan membuat software pembelajaran videografi berbentuk multimedia interaktif yang diperuntukkan bagi pemula dalam bidang videografi. Berdasarkan hasil konsultasi dengan pakar bidang videografi, menunjukkan bahwa materi yang disajikan pada multimedia interaktif ini telah memenuhi syarat untuk digunakan oleh pemula dalam bidang videografi. Sedangkan hasil konsultasi dengan pakar bidang komputer menunjukkan bahwa software ini secara teknis telah memenuhi syarat dan sangat efektif karena selain mudah dioperasikan, software ini memiliki ukuran file yang relatif kecil sehingga tidak membutuhkan spesifikasi komputer yang terlalu tinggi. 007 Wulandari, Nuning; Lestari, Sri Rahayu. 2007. Pengaruh Perasaan Daun Tapakdara (Chataranthus Roseus, L.) G. Don terhadap Jumlah Spermatozoa Mencit ( Mus musculus, L, ) Dewasa Galur A/J

Kata-kata kunci: daun Tapakdara, spermatozoa, antispermatogenesis

Tapakdara adalah salah satu jenis tanaman tropis yang mempunyai banyak manfaat. Daun tapakdara mengandung alkaloid yang secara in vitro signifikan menghambat pembelahan dan mengganggu pembelahan normal spermatosit primer belalang (Syifudin, 1997 dan Dewi, 2006). Walaupun secara in vitro daun tapakdara terbukti dapat menghambat pembelahan spermatosit primer tetapi belum ada bukti ilmiah yang menunjukkan perasaan tapakdara dapat menghambat pembentukan spermatozoa secara in vivo. Penelitian ini bertujuan untuk mengetahui dampak pemberian perasan daun tapakdara (Charathus Roseus, L.) G. Don terhadap jumlah spermatozoa mencit (Mus musculus, L.) dewasa galur A/J. Penelitian ini merupakan penelitian eksperimen dengan Rancangan Acak Lengkap (RAL). Sebagai perlakuan dalam penelitian ini adalah konsentrasi perasaan daun tapakdara dengan 6 ulangan. Pemberian perasan daun tapakdara dilakukan selama 36 hari secara oral dengan alat gavage. Dosis yang digunakan adalah perlakuan A = plasebo (kontrol), dan berturut-turut perlakuan B, C, dan D adalah 10%, 20%, dan 30%. Data jumlah spermatozoa dianalisis dengan Anava satu jalur dan bila ada pengaruh akan dilanjutkan dengan Uji BNT. Hasil penelitan menunjukkan bahwa ada pengaruh perasan daun tapakdara terhadap penurunan jumlah spermatozoa pada mencit dewasa

Edisi ke-27 Tahun 2008

7

galur A/J. Penurunan jumlah spermatozoa dari tertinggi sampai terendah berturut-turut adalah dari perasan dengan konsentrasi 30%, 20%, dan 10%. 008 Octaviana, Luckky Tri; A., Susy Kuspambudi; Yunus, Mahmuddin. 2007. Penggunaan Graphmatica dalam Pembelajaran Matematika dan Pengaruhnya pada Kemampuan Pemahaman Konsep dan Penalaran Mahasiswa

Kata-kata kunci: graphmatica, pembelajaran Matematika konsep dan penalaran,

Dalam pembelajaran Matematika, khususnya dalam menggambar grafik persamaan, banyak ditemui mahasiswa yang mengalami kesulitan. Pada umumnya mahasiswa tidak terlalu peduli pada hakikat konsep, yang diutamakan adalah mendapatkan hasil akhir. Hal itu diduga kuat sebagai akibat dari metode pembelajaran Matematika yang diperoleh majhasiswa di SMA dan sebelumnya. Lemahnya mahasiswa pada pemahaman konsep, karena mahasiswa banyak diarahkan untuk dapat menjawab soal bentuk obyektif, yang lebih mementingkan jawaban akhir daripada pemahaman konsep. Graphmatica diharapkan dapay menyelesaikan permasalahan seperti menggambar grafik fungsi persamaan maupun pertidaksamaan, fungsi trigonometri, turunan fungsi, integral, dan sebagainya. Disamping itu hasil grafik dari graphmatica dapat disekspor dengan software lainnya seperti microsoft word untuk keperluan dokumentasi, atau microsoft powerpoint untuk presentasi. Bahkan hasil perhitungan dari graphmatica dapat diakses untuk aplikasi web site. Penelitian ini dilakukan dalam dua siklus kegiatan yaitu siklus-1 dan siklus-2. Masing-masing siklus menurut terdiri atas 4 (empat) tahapan kegiatan, yaitu: (1) menyusun rencana tindakan; (2) melaksanakan tindakan; (3) melakukan pengamatan; dan (4) melakukan analisis dan refleksi. Pada penelitian ini diperoleh kesimpulan, bahwa perkuliahan kalkulus dengan menggunakan graphmatica dapat meningkatkan pemahaman mahasiswa. Disamping itu mahasiswa merasa senang, karena mereka punya kesempatan untuk menambah pengetahuan prasyarat yang harus dipunyainya dalam menempuh matakuliah kalkulus. 009 Prabaningtyas, Sitoresmi; Witjoro, Agung. 2007. Uji Daya Antimikroba Ekstrak Daun Segar dan Daun Kering Berbagai Tanaman Obat

8

Abstrak Hasil Penelitian

dengan Metode Infus dan Rebusan terhadap Bakteri Staphylococcus Aureus

Kata-kata kunci: daya antimikroba, daun segar, daun kering, metode infuse dan rebusan

Penelitian tentang uji daya Antimikroba akstrak daun segar dan daun kering berbagai tanaman obat dengan metode infus dan rebusan terhadap bakteri Staphylococcus aureus sangat penting dilakukan. Melalui penelitian ini dapat diketahui kondisi daun dan metode ekstraksi yang tepat. Berbagai daun tanaman dimanfaatkan sebagai obat-obatan di Indonesia. Penelitian ini menggunakan bermacam-macam daun yaitu daun jambu biji (Psidium guajava L), daun kucing-kucingan (Achalypha indica L), daun Meniran (Phyllanthus niruri L), daun beluntas (Plucea Indica [L] Less), daun kemuning (Murraya peniculata [L] Jack) dan daun bandotan (Ageratum conyzoides L). Penelitian eksprimen ini bertujuan untuk mengetahui perbedaan daya antimikroba ekstrak daun segar dan daun kering berbagai tanaman obat dengan metode infus dan rebusan terhadap bakteri Staphylo-coccus aureus dan untuk mengetahui kondisi daun dan metode ekstraksi yang daya antimikrobanya besar. Hasil penelitian menunjukkan bahwa tidak ada perbedaan daya antimikroba ekstrak daun segar dan daun kering berbagai tanaman obat dengan metode infuse dan rebusan terhadap bakteri Staphylococcus aureus. 010 Suaidi, Daeng Achmad; Yunus, Mahmuddin. 2007. Perancangan Multimedia Interaktif Pembelajaran Sains untuk Siswa Sekolah Dasar

Kata-kata kunci: multimedia, interaktif, sains

Multimedia interaktif pembelajaran sains merupakan salah satu bentuk implementasi dari perkembangan kurikulum berbasis kompetensi, dimana siswa diharuskan aktif terlibat dalam kegiatan belajar, sedangkan guru sebagai mediator. Tetapi untuk kebutuhan praktis yang disesuaikan dengan silabus pembelajaran, selama ini masih belum cukup memadai ketersediaan media pembelajaran sains berbasis multimedia interaktif untuk tingkat Sekolah Dasar. Untuk mengembangkan multimedia interaktif tersebut dalam penelitian ini digunakan metodologi dengan langkah-langkah sebagai berikut: Memilih Topik, Merancang dan Membuat Perangkat Lunak/Modul Pembelajaran, Konsultasi dengan Tim Ahli (Pakar), Revisi Perangkat Lunak, Uji Coba ke

Edisi ke-27 Tahun 2008

9

Guru (Calon Guru), Revisi Perangkat Lunak, Uji Coba ke Siswa, Revisi Perangkat Lunak. Dari hasil uji coba kepada beberapa guru dan siswa, media pembelajaran ini dapat membantu proses belajar mengajar dan tidak sulit dalam mengaplikasikan. Berdasarkan hasil validasi dari pakar pendidikan diperoleh rata-rata nilai 3,67; dari pakar komputasi diperoleh nilai rata-rata 3,73; dari guru/pengajar diperoleh nilai rata-rata 3,67. Sedangkan rata-rata nilai validasi secara keseluruhan adalah 3,69. Karena nilai > 3 maka media pempelajaran ini cukup valid. 011 Anwar, Lathiful; Qohar, Abd. 2007. Pengembangan Model Pembelajaran Matematika pada Materi Geometri melalui Pembelajaran Berbasis Komputer (PBK) untuk Meningkatkan Pemahaman Siswa Sekolah Menengah Pertama (SMP)

Kata-kata kunci: pembelajaran berbasis computer, geometri, Laboratorium visul, multimedia

Pembelajaran berbasis komputer merupakan pilihan tempat untuk melaksanakan pembelajaran matematika di SMP khususnya mateeri geometri. Melalui pembelajaran berbasis komputer, siswa lebih muda memahami apa yang sedang dipelajari karena penyajiannya dibuat semenarik mungkin, sehingga belajar merupakan sesuatu yang menyenangkan bagi siswa. Dengan demikian siswa memiliki motivasi yang kuat untuk selalu ingin belajar. Oleh karena itu penelitian ini sangat penting dilakukan dalam upaya untuk menghasilkan perangkat lunak pembelajaran berbasis komputer bagi siswa SMP yang telah teruji keefektifan dengan tujuan untuk membantu menumbuhkan motifasi belajar pada diri siwa SMP. Penelitian ini bertujuan untuk mendesain produk perangkat lunak PBK kemampuan geometri siswa SMP berdasarkan karakteristik yang telah dispesifikasikan sebelumnya. Materi geometri yang digunakan sesuai dengan kurikulum SMP 2004 kelas 3 yaitu bentuk-bentuk geometri dan unsur-unsurnya, macam-macam bangun datar dan ruang, volume, luas, serta keliling dari bangun. Pembelajaran ini disertai dengan soal-soal latihan yang didesain menyerupai permainan dengan data-data soal yang dapat di Update. Beradasarkan validasi dari para pakar pendidikan (Dra. Sri Mulyati, M.Pd) diperoleh rata-rata 3,67; dari pakar komputasi (Moch. Yasin, S. Kom, M. Kom) diperoleh nilai rata-rata 3,73; dari guru ( Mujiati, S.Pd ) diperoleh

10

Abstrak Hasil Penelitian

nilai rata-rata 3,60. Sedangkan rata-rata nilai validasi secara keseluruhan adalah 3,67. Karena nilai validasi > 3 maka media pembelajaran ini dianggap cukup valid. 012 Zaini, Ilham Ari Elbaith Zaini; Aripriharta. 2007. Pembuatan Perangkat Lunak Pengubah Teks Menjadi Suara sebagai Alat Bantu pada Pembelajaran Mendengarkan (Listening) Mata Kuliah Bahasa Inggris

Kata-kata kunci: text to speech, media pembelajaran, pembelajaran bahasa Inggris

Salah satu keterampilan yang dibutuhkan oleh tenaga kerja dari dalam negeri yang harus diberikan oleh lembaga pendidikan, khususnya perguruan tinggi adalah keterampilan berbahasa Inggris. Akan tetapi selama ini pembelajaran itu kebanyakan hanya berupa pembelajaran bahasa inggris pasif yang kebanyakan materinya adalah membaca (reading) dan menulis (writing). Sedangkan materi pembelajaran bahasa inggris aktif yang tertdiri dari materi mendengarkan (listening) dan berbicara (speaking) terasa sangat kurang. Penelitian ini bertujuan untuk membuat sebuah prototipe perangkat lunak pengubah teks menjadi suara. Perangkat lunak ini diharapkan dapat digunakan sebagai media pembelajaran bahasa Inggris khususnya untuk materi mendengarkan (listening). Dari hasil pengujian dapat diketahui bahwa perangkat lunak yang dibuat dapat bekerja sesuai dengan rancangan bahwa sistem mampu menghasilkan suara percakapan ketika isi kolom D pada basis data adalah percakapan (dengan kode M atau F), sistem mampu menghasilkan suara percakapan dan tampilan teks ketika isi kolom D pada basis data adalah pertanyaan (dengan kode Q ), serta sistem mampu menghasilkan tampilan teks ketika isi kolom D pada basis data adalah ( a, b, c, atau d ). Dengan demikian dapat dikatakan bahwa sistem perangkat lunak yang dibuat dapat bekerja sesuai dengan yang diharapkan Dari hasil pengujian diatas dapat diketahui bahwa secara rata-rata terjadi peningkatan nilai yang diperoleh mahasiswa dari 56.13 menjadi 61.2. Hal ini menunjukkan bahwa setelah beberapa kali berlatih mengerjakan soalsoal mendengarkan (listening) berbahasa Inggris menggunakan perangkat lunak pengubah teks menjadi suara kemampuan mendengarkan mahasiswa meningkat dengan demikian maka dapat dikatakan bahwa terjadi peningkatan kemampuan mahasiswa dalam mendengarkan bacaan atau percakapan dalam bahasa Inggris.

Edisi ke-27 Tahun 2008

11

013 Sendari, Siti; Pranoto. 2007. Pengaruh Kepadatan Lalu Lintas terhadap Kadar Gas CO (Carbon Monoxide) untuk Kalibrasi Sensor gas sebagai Indikator Kemacetan Lalu Lintas

Kata-kata kunci: kadar CO, kemacetan jalan, topografi, kalibrasi, sensor gas

Penelitian ini bertujuan untuk mengetahui pengaruh kepadatan lalu lintas terhadap kadar CO untuk kalibrasi sensor gas sebagai indikator kemacetan lalu lintas. Penelitian dilaksanakan di Jalan Sukarno-Hatta dan Sumbersari, sebagai sampel jalanan padat di Kotamadya Malang dengan karakteristik pengguna yang sama tetapi memiliki topografi yang berbeda. Penelitian dilaksanakan tanggal 26-27 September 2007 dan 1-2 Oktober 2007 pada range jam 06.00--08.00 WIB. Analisis yang digunakan dalam penelitian ini adalah analisis (1) regresi untuk melihat pengaruh kepadatan lalu lintas dan (2) analisis komparasi untuk melihat pengaruh topografi terhadap peredaan kadar CO di kedua jalan raya tersebut. Hasil pengukuran tersebut digunakan sebagai bahan uji coba laboratorium untuk menentukan kalibrasi sensor Gas CO sebaga indicator kemacetan lalu lintas. Hasil penelitian menunjukkan bahwa terdapat pengaruh signifikan antara kadar CO dengan jumlah kendaraan yang melintas di jalan raya. Kadar CO di jalan Sumbersari lebih tinggi daripada kadar CO di jalan Sukarno-Hatta, yaitu pada pukul 05:57--07:19 WIB rata-rata kadar CO Jalan Sukarno-Hatta 7,8688 ppm dan Jalan Sumbersari 23,28577 ppm, sedangkan pada pukul 07:13--08:03 WIB rata-rata kadar CO di jalan Sukarno-Hatta 15,6127 ppm dan Jalan Sumbersari 28,2568 ppm. Hasil ini digunakan untuk uji Laboratorium untuk mengetahui pengaruh kadar CO terhadap tegangan elektrik sensor gas CO. Pengaruh ini dinyatakan sebagai persamaan Y=0,797+ 0,025X. Rangkaian sensor gas kemudian diterapkan pada rangkai-an pengkondisi sinyal sehingga diperoleh fungsi linear pengkondisi sinyal Y=3,0196+3,67X, dimana tegangan maksimal yang dihasilkan adalah 4,49V untuk kadar CO 50ppm. 014 Nur Afandi, Arief; Rahmawati, Yuni; Sujito. 2007. Pengaruh Hostload Pembangkit terhadap Profil Tegangan

Kata-kata kunci: stabilitas, generator, drop, hostload

Gangguan dapat mempenggaruhi stabilitas transient yang merupakan keandalan sistem untuk mempertahankan keadaan sinkron. Selain itu stabilitas transient dipengaruhi juga oleh kekutan jaringan transmisi dan tie

12

Abstrak Hasil Penelitian

line ke sistem-sistem yang berdekatan, karakteristik unit-unit pembangkit meliputi moment inersia bagian yang berputar, transient reactance dan karakteristik magnetik saturasi dari stator dan rotor. Masalah stabilitas sistem tenaga ini menyangkut kondisi blackout pada kota Malang, sehingga jika terjadi pemadaman total akibat terjadinya gangguan dapat dilakukan tindakan segera untuk recoveri. Berdasarkan hasil analisa menunjukkan terjadinya perubahan akibat adanya operasi hostload pembangkit, yaitu terjadi perubahan tegangan pada setiap bus, tetapi bus terdekat dengan pembangkit mengalami perubahan tegangan yang besar, sedangkan pada bus yang jauh merasakan pengaruh operasi hostload yang sangat kecil. Akibat adanya operasi hostload, maka perubahan terbesar terjadi pada bus Wlingi dan bus sutami, yaitu kurang lebih 1 kV atau 1.000 volt. 015 Sholihul Hadi, Mokh.; Zaeni, Ilham Ari Elbaith. 2007. Pembuatan Perangkat Lunak Pengirim SMS sebagai Sarana Pemberi Informasi Fasilitas Umum dan Tempat Rekreasi di Kota Malang Beserta Informasi Jalur yang Harus Ditempuh

Kata-kata kunci: pembuatan perangkat lunak, informasi fasilitas umum

Tujuan penelitian ini secara umum adalah menghasilkan suatu karya cipta yang mampu mengirimkan informasi fasilitas umum dan tempat rekreasi di kota Malang beserta informasi jalur yang harus ditempuh dengan menggunakan media short message service (SMS). Penelitian ini diharapkan dapat memberikan manfaat kepada masyarakat luas yang ingin memanfaatkan fasilitas umum dan mengunjungi obyek wisata yang ada di kota Malang, dengan memberikan layanan akses informasi mudah dan murah tentang tempat yang akan mereka kunjungi. Penelitian ini juga diharapkan dapat memberikan manfaat kepada pemerintah kota Malang, sebagai sarana yang membantu untuk mewujudkan salah satu visi kota Malang sebagai kota pariwisata. Pada pengembanggan selanjutnya karya cipta yang dibuat dapat dikembangkan, sehinnga dapat memberikan informasi lengkap mengenai tempat yang akan dikunjungi dengan menyertakan informasi foto tempat yang akan dituju, sejarah, tarif tiket masuk, dan tempat penginapan terdekat dengan obyek yang akan dituju. Dengan menggunakan program delphi diperoleh sebuah perangkat lunak yang mampu menerima dan mengolah kode perintah yang diberikan melalui pengiriman sms. Penambahan aplikasi database pada program memungkinkan perangkat lunak menyimpan informasi dan mengirimkannya kepada

Edisi ke-27 Tahun 2008

13

pengguna yang inginmemperoleh informasi tentang fasilitas umu di kota Malang. Informasi yang dikirimkan berupa alamat lengkap, nomor telepon, dan nama angkutan kota yang melewati rute terdekat dengan fasilitas umum yang akan dituju. 016 Mentari, Sriyani; Handayani, Puji. 2007. Analisis Metode Cooperative dan Classical Learning, Hubungannya dengan Gaya Kognitif Serta Pengaruhnya terhadap Hasil Belajar Mahasiswa

Kata-kata kunci: cooperative and classical learning, cognitif style

Penelitian ini bertujuan untuk mengetahui perbedaan hasil belajar mahasiswa antara metode cooperative dan klasikal, serta perbedaan hasil belajar pada mata kuliah Aspek Hukum Ekonomi dan Bisnis bila dikaitkan dengan tipe gaya kognitif field independent (FI) dan field dependent (FD). Rancangan penelitian menggunakan desain eksperimen dengan kelas kontrol menggunakan metode klasikal dan kelas eksperimen (metode koopertif teknik jigsaw). Dengan teknik random sampling diperoleh sampel penelitian berjumlah 80 mahasiswa. Teknik analisis data menggunakan anova. Hasil penelitian menunjukkan bahwa terdapat perbedaan hasil belajar antara metode kooperatif dan klasikal, tetapi tidak terdapat perbedaan hasil belajar mahasiswa antara gaya kognitif tipe field independent dan field dependent. Pada kelas kooperatif, tidak terdapat perbedaan hasil belajar mahasiswa antara tipe gaya kognitif FI dan FD, sedangkan pada kelas klasikal terdapat perbedaan hasil belajar antara mahasiswa yang bertipe gaya kognitif FI dan FD. Hasil penelitian ini menyarankan agar menggunakan teknik jigsaw sebagai alternatif metode pembelajaran. 017 Pujiningsih, Sri; Sulastri; Larasati, Ika Putri. 2007. Preferensi Gaya Belajar Mahasiswa Akuntansi Fakultas Ekonomi UM

Kata-kata kunci: mahasiswa, akuntansi, gaya belajar

Setiap mahasiswa akan memiliki preferensi gaya belajar yang berbeda. Ttujuan penelitian ini adalah untuk mengetahui perbedaan dan preferensi gaya belajar pada mahasiswa Prodi S1 Pendidikan Akuntansi, S1 Akuntansi dan D3 Akuntansi. Mengingat bahwa pemahaman terhadap gaya belajar mahasiswa tersebut dapat dijadikan dasar untuk strategi pengajaran yang dilakukan oleh dosen.

14

Abstrak Hasil Penelitian

Penelitian ini merupakan jenis penelitian komparasi. Populasi dalam penelitian ini adalah mahasiswa Prodi D3 Akuntansi, Prodi S1 Pendidikan Akuntansi, dan Prodi S1 Akuntansi FE-UM yang terdaftar pada semester gasal tahun 2007. Adapun teknik pengambilan sampel dilakukan dengan metode convenience sampling. Jenis data yang digunakan dalam penelitian ini adalah data primer. Teknik analisis data yang digunakan yaitu teknik ANOVA dan Uji Z. Berdasarkan hasil uji dengan menggunakan teknik ANOVA, diketahui bahwa tidak terdapat perbedaan gaya belajar antara mahasiswa di ketiga prodi, yakni Prodi S1 Pendidikan Akuntansi, S1 Akuntansi dan D3 Akuntansi. Sedangkan untuk preferensi gaya belajar yang pertama di ketiga prodi adalah sama, yakni mereka memiliki gaya belajar detail (sesuai dengan Canfaild Model) atau sensing (dalam MBTI Model). Untuk preferensi gaya belajar kedua, mahasiswa Prodi S1 Pendidikan Akuntansi bergaya extrovert learner (dalam MBTI Model), direct experiment (canfaild model) serta accomodator (Kolb Model). Untuk preferensi gaya belajar kedua, mahasiswa S1 Akuntansi bergaya visual (dalam canfaild model), dan diverger (Kolb Model). Untuk preferensi gaya belajar kedua pada mahasiswa D3 Akuntansi adalah gaya competition (dalam canfaild model). Berdasarkan hasil penelitian yang telah dilakukan dapat direkomendasikan hal-hal sebagai berikut untuk strategi pembelajaran (1)dalam penyampaian materi di kelas untuk ketiga Prodi, hendaknya dosen menjelaskan materi secara terperinci disertai dengan contoh dan (2) dengan memperhatikan preferensi gaya belajar kedua, untuk mahasiswa S1 Pendidikan Akuntansi hendaknya dosen dalam pembelajaran lebih banyak menggunakan collaborative learning atau pun problem based learning. Untuk mahasiswa S1 Akuntansi, dalam penyampaian materi di kelas, hendaknya menggunakan multimedia berbasis komputer yang diproyeksikan dengan LCD, karena mereka lebih banyak bergaya visual. Sedangkan untuk mahasiswa D3 Akuntansi, hendaknya dosen dapat menciptakan lingkungan pembelajaran yang kompetitif, yang dapat merangsang mahasiswa untuk mendapatkan nilai yang terbaik. 018 Sumanto, Agus; Soesetio, Yuli. 2007. Studi Derajat Otonomi Fiskal Propinsi Jawa Timur Tahun 1998--2003

Kata-kata kunci: otonomi fiskal, otonomi daerah, pertumbuhan ekonomi daerah

Era otonomi daerah dan kebijakan desentralisasi fiskal telah menjadi landasan perencanaan pembangunan daerah di Indonesia. Dengan sema-

Edisi ke-27 Tahun 2008

15

ngat otonomi daerah, pemerintah daerah bersama-sama dengan rakyatnya dapat melakukan inovasi pembangunan sesuai dengan tujuan dan sumber daya yang tersedia. Dari aspek keuangan daerah, implikasi dari kebijakan desentralisasi fiscal adalah kemandirian daerah dalam mengelola keuangan daerahnya secara otonom. Kemandirian keuangan daerah ini dapat dilihat sebagai derajat otonomi fiskal yang dimilik setiap daerah dalam melaksanakan pembangunannya. Namun demikian secara empiris, derajat otonomi fiskal tersebut juga dapat dipengaruhi oleh variabel-variabel ekonomi yang lain dalam perekonomian. Penelitian ini bertujuan untuk menganalisis faktor-faktor yang mempengaruhi otonomi fiscal di Propinsi Jawa Timur selama tahun 1998-2004. Dengan menggunakanm model regresi OLS, hasil penelitian ini memberikan kesimpulan bahwa diantara variabel-variabel bebas seperti PDRB, investasi dan bantuan pemerintah pusat, hanya variabel PDRB yang tidak memiliki pengaruh terhadap otonomi fiskal di Jawa Timur. 019 Wiyono, Mardi; Sutrisno; Amin, Moh.; Susilowati. 2007. Pemetaan Potensi dan Formulasi Pengembangan Pusat Penelitian Lingkungan Hidup Lembaga Penelitian Universitas Negeri Malang

Kata-kata kunci: analisis SWOT, pemetaan potensi, formulasi pengembangan

Penelitian ini bertujuan untuk memetakan potensi dan memformulasikan pengembangan PPLH Lemlit UM dalam rangka pengembangan ke depan sesuai dengan kondisi dan situasi saat ini berdasarkan analisis SWOT. Penelitian ini dilakukan dengan menggunakan metode deskriptif. Kekuatan, kelemahan, peluang, tantangan, dan pola pengembangan dideskripsikan secara kualitatif dari hasil diskusi, brainstorming, dan analisis dokumentasi penelitian yang relevan. Hasil penelitian menunjukkan bahwa sumberdaya peneliti yang aktif di PPLH Lembaga Penelitian UM berjumlah 60 orang. Peneliti yang berasal dari FIP sebanyak 4 orang (6,67%), FS sebanyak 4 orang (6,67%), FMIPA sebanyak 45 orang (75%), dan FT sebanyak 7 orang (11,67%). Sumberdaya non peneliti di PPLH atau staf Lembaga Penelitian yang berjumlah 13 orang. Berangkat dari kekuatan, kelemahan, peluang, dan tantangan PPLH, strategi yang ditempuh antara lain: memperkuat tim kerja, memperbaiki program kerja, meningkatkan kualitas layanan, dan memperluas jaringan kerjasama.

16

Abstrak Hasil Penelitian

020 Ibrahim, Abbdul Syukur; Fatchan, Ach. 2007. Pengembangan Buku Panduan bagi Wisatawan dan Buku Pemandu Wisata Wilayah Malang Raya dalam Bidang Wisata Seni Kriya Unggulan

Kata-kata kunci: seni kriya, wisata Malang

Malang Raya merupakan kawasan tujuan wisata nomor satu di Jawa Timur. Hal ini di dukung oleh adanya keindahan alam dan ragam budaya yang dimiliki oleh kawasan ini. Seni kerajinan merupakan salah satu produk budaya yang banyak tersebar di kawasan tersebut, yang menempati beberapa sentra. Hal ini perlu dikemas untuk dijadikan tujuan wisata kerajinan di masa mendatang. Karena banyak satu-satu kerajinan menghasilkan produk-produk kerajinan yang memiliki keunikan baik yang berkaitan dengan desain produknya maupun teknik pembuatannya. Melalui penelitian ini bertujuan untuk menghasilkan produk buku panduan bagi wisatawan dan buku pemandu wisatawan yang nantinya dapat memberikan gambaran tentang profil seni kerajinan tersebut. Yang mana informasi tersebut dapat memberikan gambaran secara lebih jelas tentang obyek kriya unggulan tersebut,oleh karena itu hasil dari penelitian ini berupa foto-foto profil kerajinan kawasan Malang raya yang dilengkapi dengan data verbal sebagai pelengkap informasi gambar/foto. Untuk tahap awal dipilih enam sentra kerajinan yang dianggap oleh peneliti merupakan produk kerajinan unggulan Malang raya. Antara lain, seni kerajinan gamelan Jun Rejo, Kerajinan Kuda Goyang Ngantang, Kerajinan Mebel Ukir Piranha, Kerjinan Keramik Dinoyo Malang, Seni Kerajinan Topeng Malangan, Seni Kerajinan Elemen Hias Tempel Arsitektur Karang Besuki. Diharapkan dari hasil penelitian ini kelak ada pihak lain yang peduli untuk mengembangkan atau memproduksi hasil penelitian ini untuk dapat diakses ke berbagai pihak. 021 Agustina, Ratna Trieka; Bintartik, Lilik; Rahayu, Suci. 2007. Studi tentang Buku Ajar Bahasa Inggris Siswa Kelas Tiga Sekolah Dasar Kota Blitar

Kata-kata kunci: buku ajar bahasa Inggris, sekolah dasar, kota Blitar

Penelitian tentang kajian buku ajar bahasa Inggris kelas 3 SD bertujuan untuk mendeskripsikan (1) pendekatan pembelajaran; (2) tujuan pembelajaran; (3) area isi atau bahan pembelajaran; dan (4) model interaksi pembelajaran. Hasil penelitian menunjukkan bahwa (1) penggunaan pendekatan integratif diimplemantasikan dengan mengintegrasikan keempat

Edisi ke-27 Tahun 2008

17

aspek keterampilan berbahasa, yakni speaking, listening, reading and writing. Pendekaan komunikatif dilaksanakan dengan berbagai kegiatan komunikasi berkaitan dengan tema dan sajian percakapan atau dialog dengan kegiatan bahasa yang belum tersaji secara utuh; (2) Peningkatan empat aspek keterampilan berbahasa sebagai tujuan pembelajaran berada dalam tataran kata, frasa, kalimat dalam dialog yang sesuai dengan tema yang dirujuk.Kegiatan berbahasa belum tersaji secara utuh dengan konsep whole language; (3) Keterbatasan vaiasi area isi atau bahan ajar kurang dapat memoivasi siswa usia sekolah dasar untuk menyenangi bahasa Inggris; dan (4) Keragaman bentuk interaksi pembelajaran dapat dilakuan dengan menghadirkan kegiatan yang disukai anak usia sekolah dasar, yakni menyanyi, bercerita, bermain peran dan permainan. Saran pengembangan buku ajar difokuskan pada penyajian yang mengarah pada konsep whole language dengan aktivitas pembelajaran learning by doing yang dapat lebih meningkatkan keterampilan bahasa Inggris siswa secara alami, kontekstual, dan bermakna. 022 Suryadharma, Ida Bagus. 2007. Penggunaan Model Siklus Belajar dan Peta Konsep untuk Meningkatkan Kualitas Pembelajaran Sains/ Kimia di SMP Negeri 8 Malang

Kata-kata kunci: siklus belajar, peta konsep, kimia SMP

Pembelajaran kimia di SMP merupakan implikasi dari pelaksanaan KTSP. Pada kurikulum sebelumnya, kimia belum diajarkan secara eksplisit di SMP melainkan terintegrasi pada matapelajaran IPA. Dampak dari itu, pembelajaran kimia di SMP belum optimal yang diketahui dari tingkat ketuntasan siswa yang masih rendah dan kualitas pembelajaran juga masih rendah. Penelitian ini bertujuan untuk meningkatkan kualitas proses dan hasil belajar kimia siswa kelas VII SMP Negeri 8 Malang pada materi pokok unsur, senyawa, dan campuran dengan menggunakan model pembelajaran siklus belajar-peta konsep. Penelitian ini menggunakan desain penelitian tindakan kelas (PTK) yang dilaksanakan dalam 2 siklus dengan prosedur penelitin pada tiap siklus terdiri dari empat tahap yaitu: perencanaan, pelaksanaan, observasi, dan refleksi. Subyek penelitian adalah siswa kelas VIIF SMP Negeri 8 Maalang yang terdiri dari 42 orang siswa. Hasil penelitian menunjukkan bahwa model pembelajaran siklus belajar-peta konsep dapat diimplementasikan dengan baik untuk mengajarkan materi kimia unsur, senyawa, dan campuran di kelas VIIF SMPN 8 Malang. Implementasi model tersebut dapat meningkatkan

18

Abstrak Hasil Penelitian

keaktifan siswa, interaksi siswa bekerja dalam kelompok, kemampuan siswa membuat peta konsep, dan hasil belajar siswa. Pada akhir siklus II, 92% siswa mencapa ketuntasan belajar dengan SKM 70. Keadaan tersebut menunjukkan bahwa implementasi model siklus belajar-peta konsep dapat meningkatkan kualitas proses dan hasil belajar kimia di SMP. 023 Suwasono, Purbo; Purwaningsih, Endang. 2007. Meningkatkan Pemahaman Kontekstual terhadap Konsep Kelistrikan Siswa SMP Laboratorium UM Malang Kelas IX Semester I melalui Pembelajaran Berbasis Observasi Gejala Fisis

Kata-kata kunci: pembelajaran berbasis observasi, kontektual, bertanya

Pembelajaran fisika di SMP Laboratorium selama ini hanya menekankan pada materi yang bersifat teoritis saja. Guru hanya memberikan rumus kemudian menyuruh siswa mengerjakan soal. Kegiatan pembelajaran semacam ini, membuat siswa tidak pernah menanyakan Bagaimana itu kita tahu? Mengapa hal tersebut dapat terjadi? Apa penyebabnya? atau Apa buktinya?. Ketika guru melakukan demonstrasi, siswa masih kebingungan membedakan antara observasi dan kesimpulan. Siswa belum mengetahui bahwa diperlukan bukti yang cukup untuk menarik kesimpulan. Hal ini menandakan kemampuan bertanya dan pemahaman kontektual mereka masih rendah. Oleh karena itu, perlu suatu upaya untuk meningkatkan pemahaman kontektual siswa dan kemampuan bertanya siswa kelas IX. Salah satunya melalui penerapan pembelajaran berbasis observasi gejala fisis dengan tahapan yaitu tahap observasi, pengajuan masalah, penyelesaian masalah, pemantapan konsep, dan evaluasi. Melalui pembelajaran tersebut, pemahaman kontekstual dan kemampuan bertanya siswa akan meningkat karena mereka selalu dihadapkan pada suatu informasi yang harus mereka analisis dan simpulkan. Penelitian ini adalah penelitian tindakan kelas dengan tindakan berupa pembelajaran berbasis observasi gejala fisis yang dilakukan dalam dua siklus. Siklus I dengan materi kelistrikan susunan seri hambatan dan siklus II dengan materi kelistrikan susunan paralel hambatan. Subjek dalam penelitian ini berjumlah 30 siswa, yang terdiri dari 13 siswa putra dan 17 siswa putri. Berdasarkan hasil observasi awal didapatkan bahwa pembelajaran fisika di Kelas IX SMP Laboratorium Malang masih bersifat konvensional sedangkan pemahaman kontekstual dan kemampuan bertanya siswa masih rendah. Sebelum pelaksanaan tindakan II, dilakukan perbaikan tindakan,

Edisi ke-27 Tahun 2008

19

antara lain guru hanya bertindak sebagai fasilitator, menginformasikan bagaimana melakukan observasi, bertanya, mengajukan hipotesis, dan menarik kesimpulan yang baik. Berdasarkan analisis dan refleksi, diketahui bahwa setelah tindakan diterapkan terjadi peningkatan persentase aspek kemampuan bertanya dari 65% pada siklus I ke 89% pada siklus II. Kemunculan aspek pembelajaran berbasis observasi meningkat dari 11 aspek (55%) pada siklus I menjadi 17 aspek (85%) pada siklus II. Prosen-tase kenaikan pemahaman konsep siswa pada siklus I adalah 33%, sedangkan siklus II adalah 43%. Akhir siklus II siswa mencapai skor pemahaman konsep 81%.. Saran yang dapat peneliti berikan, sebaiknya guru mempraktikkan pembelajaran berbasis observasi gejala fisis sebagai alternatif pembelajaran untuk meningkatkan pemahaman kontekstual dan kemampuan bertanya siswa. 024 Parlan; Munzil. 2007. Identifikasi Lingkungan Industri untuk Pengembangan Bahan Ajar Pendidikan Lingkungan Hidup (PLH) di Sekolah dalam Upaya Menciptakan Sekolah Berbudaya Lingkungan (SBL) di Wilayah Tulungagung

Kata-kata kunci: lingkungan industri, bahan ajar, sekolah berbudaya lingkungan

Akhir-akhir ini banyak dijumpai fenomena-fenomena alam yang menunjukkan rusaknya ekosistem. Untuk mengantisipasi kerusakan yang lebih parah lagi, maka diperlukan upaya untuk meningkatkan kesadaran masyarakat akan pentingnya menjaga kelestarian lingkungan. Salah satu cara yang bisa ditempuh adalah melalui jalur pendidikan dengan cara memasukkan materi lingkungan (sebagai semacam muatan lokal) ke dalam kurikulum sekolah. Melalui jalur pendidikan juga bisa dilakukan dengan membentuk sekolah berbudaya lingkungan (SBL), yaitu sekolah yang setiap aspek kegiatannya selalu berorientasi pada upaya menjaga kelestarian lingkungan. Untuk mendukung kegiatan tersebut diperlukan perangkat pendukung merupa media-media pembelajaran yang dapat digunakan sebagai sumber belajar bagi guru dan siswa. Melalui sumber-sumber belajar yang tepat dapat dihadirkan peristiwa-peristiwa dalam dunia nyata ke dalam kelas sehingga apa yang dipelajari siswa di sekolah senantiasa terkait dengan pengalaman siswa dalam kehidupan sehari-hari (kontekstual). Tujuan penelitian ini adalah mengidentifikasi lingkungan industri yang dapat digunakan sebagai bahan pengembangan bahan ajar pendidikan lingkungan hidup di wilayah Tulungagung.

20

Abstrak Hasil Penelitian

Penelitian ini menggunakan rancangan penelitian survey dengan langkah-langkah sebagai berikut: (1) mengidentifikasi sumber-sumber (industri) di wilayah Kabupaten Tulungagung yang dapat digunakan sebagai bahan penyusunan bahan ajar PLH di sekolah; (2) mengambil gambar, suara, dan atau rekaman film dari sumber-sumber yang telah diidentifikasi; dan (3) mengelompokkan (klasifikasi) bahan-bahan yang telah terkumpul ke dalam kelompok-kelompok yang dapat menyebabkan pencemaran udara, air, dan tanah. Hasil-hasil yang diperoleh dari penelitian ini adalah: (1) Aktivitasaktivitas industri yang dapat digunakan sebagai bahan penyusunan bahan ajar lingkungan hidup dapat diidentifikasi dengan melakukan survey atau pengamatan langsung ke industri-industri terkait dengan mengamati aspekaspek yang dihasilkan industri yang mengakibatkan pencemaran lingkungan dan (2) Terdapat banyak lingkungan industri yang dapat digunakan sebagai sumber yang dapat digunakan sebagai bahan penyusunan bahan ajar lingkungan hidup. 025 Hawa Tuarita dan Sofia Ery Rahayu. 2007. Studi Eksplorasi Jenis-jenis Tumbuhan dan Hewan di Kabupaten Tulungagung untuk Pengembangan Bahan Ajar Pendidikan Lingkungan Hidup di Sekolah

Kata-kata kunci: jenis tumbuhan dan hewan, bahan ajar , lingkungan hidup

Kabupaten Tulungagung merupakan daerah yang memiliki variasi habitat yaitu daratan dan perairan. Akibatnya memungkinkan keberadaan keanekaragaman hayati di kabupaten Tulungagung cukup tinggi. Berdasarkan data dari Dinas Pemerintah Kabupaten Tulungagung menunjukkan bahwa keanekaragaman hayati belum banyak yang diketahui atau diteliti. Kurikulum Berbasis Kompetensi (KBK) dan Kurikulum Tingkat Satuan Pendidikan (KTSP) menuntut ciri pembelajaran kontekstual. Untuk pembelajaran kontektual maka diperlukan materi yang menggambarkan kondisi riil lingkungan sekitar. Tujuan penelitian ini untuk melakukan eksplorasi jenis tumbuhan dan hewan yang ada di kawasan hutan di Kabupaten Tulungagung Penelitian ini merupakan penelitian deskriptif eksplorasi. Penelitian dilaksanakan pada bulan Oktober 2007 di kawasan Hutan Pantai Sine, Hutan Kota, dan Hutan Lindung Kalangbret Kabupaten Tulungagung. Data yang diperoleh selama penelitian akan dianalisis secara deskriptif. Hasil penelitian menunjukkan bahwa ada 12 jenis tumbuhan dan 11 jenis hewan di Hutan Pantai Sine. Ditemukan 28 jenis tumbuhan dan 7 jenis

Edisi ke-27 Tahun 2008

21

hewan di Hutan Kota, sedangkan di Hutan Lindung ditemukan 35 jenis tumbuhan dan 12 jenis hewan. 026 Kusumaningrum, Desi Eri; Muslihati. 2007. Wacana Kesetaraan Gender dalam Pembelajaran di Kelas Tinggi Minu Kraksaan Probolinggo

Kata-kata kunci: kesetaraan jender, pembelajaran kelas tinggi

Perkembangan kepribadian, salah satunya identitas gender diawali perkembangannya ditingkat pendidikan dasar. Di sekolah dasarlah berlangsung transformasi pengetahuan dan nilai-nilai kehidupan pada diri anak-anak melalui pendampingan guru. Proses ini membentuk perkembangan pola pikir, tingkah laku dan mozaik kepribadian manusia sebagai mahluk sosial, termasuk di dalamnya pandangan mengenai peran manusia berdasarkan jenis seks atau peran gender. Penelitian ini didasari ketertarikan untuk mengkaji lebih jauh dalam tataran praktis mengenai kesetaraan gender dalam pembelajaran di sekolah dasar berbasis Islam pada setting kelas tinggi. 027 Prameswari I., Sri; Syafruddin, Dudy. 2007. Pandangan Mahasiswa UM terhadap Kesehatan Reproduksi

Kata-kata kunci: kesehatan reproduksi, seks pra nikah, aborsi

Pengetahuan tentang kesehatan reproduksi menjadi sangat penting ketika kasus penyakit menular seksual semakin merebak di masyarakat. Kasus-kasus tersebut bahkan seringkali dialami oleh kaum muda. Kehidupan yang bebas serta informasi yang tidak benar tentang kesehatan reproduksi semakin memperburuk permasalahan ini. Penelitian ini mencoba untuk mengetahui pandangan Mahasiswa Universitas Negeri Malang tentang kesehatan reproduksi yang meliputi tentang seks pranikah, aborsi serta penyakit menular seksual (PMS). Metode yang digunakan dalam penelitian ini adalah kualitatif dengan jenis deskriptif-interpretatip 85% mahasiswa telah mengetahui tentang kesehatan reproduksi sebagai kasehatan yang berhubungan dengan alat-alat reproduksi, fertilitas serta alat reproduksi yang sehat dan normal serta berfungsi sebagaimana mestinya. Sementara sisanya (15%) menjawab tidak tahu tentang kesehatan reproduksi dan 74% setuju jika ada lembaga pusat informasi kesehatan reproduksi di lingkungan Kampus UM.

22

Abstrak Hasil Penelitian

028 Nora, Elfia; Mintarti, Sri Umi. 2007. Profil Organisasi Kemahasiswaan Universitas Tahun 20004-2007 (Studi Organisasi Berspektif Gender)

Kata-kata kunci: kepemimpinan, gaya kepemimpinan, prestasi

Penelitian ini bertujuan untuk mendeskripsikan tantang profil Organisasi Kemahasiswaan Universitas Negeri Malang Tahun 2004-2007 (Study Organisasi Kampus Berspektif Gender). Penelitian ini menggunakan pendekatan kualitatif dan rancangan studi kasus ekploratory. Subjek penelitian ini adalah mahasiswa laki-laki dan mahasiswa perempuan yang aktif dalam organisasi kemahasiswaan Universitas Negeri Malang. Hasil penelitian menunjukkan bahwa mahasiswa laki-laki dan mahasiswa perempuan sama­sama mendapatkan kesempatan untuk menduduki posisi kepemimipinan yang sama dalam melakukan tugas, fungsi, tanggung jawab, serta mendapatkan dukungan dari seluruh mahasiswa dalam organisasi. Tetapi, dalam tahun 2004 sampai 2007 mahasiswa laki-laki lebih mendominasi posisi sebagai pemimpin dibandingkan mahasiswa perempuan. Gaya kepemimpinan mahasiswa perempuan yang lebih dominan adalah gaya partisipatif dan motivatif. Mahasiswa laki-laki lebih sering mendapatkan prestasi daripada mahasiswa perempuan dalam kegiatan organisasi. 029 Maryami, Tri; Eli Hendrik, Sanjaya. 2007. Optimasi Degradasi Cemaran Antibiotik dalam Air Susu Sapi Segar Menggunakan Enzim Pinisilinase

Kata-kata kunci: air susu sapi segar, antibiotik, enzim -Laktamase , dosis optimum

Hasil penelitian menunjukkan bahwa residu antibiotik penisilin dan Streptomisin dalam susu sapi yang dipanaskan dengan suhu diatas 100°C dan sterillisasi dalam autoclave masih dapat terdeteksi (Harlia E., dkk., 2006). Menurut Morin dan Morgan (1982), -laktamase menghidrolisis ikatan amida siklik dalam molekul yang mengandung -laktam (misalnya, penisilin dan sefalosporin). Apabila cincin -laktam pada penisilin dihidrolisis oleh laktamase maka akan dihasilkan senyawa sejenis yang tidak memiliki aktivitas antibiotik, yaitu senyawa penisiloat dengan proporsi yang stoikiometri. Tujuan yang ingin dicapai dalam penelitian ini adalah untuk mengetahui apakah cemaran antibiotic dalam air susu sapi segar dapat didegradasi dengan enzim -Laktamase komersial dan untuk mengetahui

Edisi ke-27 Tahun 2008

23

bagaimana kondisi (dosis dan perlakuan) enzim, agar diperoleh degradasi yang optimal terhadap cemaran antibiotic dalam air susu sapi segar. Penelitian dirancang sebagai berikut: (1) uji coba degradasi antibiotik dengan enzim -laktamase produksi pabrik; (2) mencari kondisi perlakuan optimal enzim dalam degradasi antibiotik; dan (3) menentukan dosis optimal laktamase produksi pabrik terhadap degradasi antibiotik. Hasil penelitian menunjukkan bahwa cemaran antibiotik dalam air susu sapi segar dapat didegradasi dengan enzim -Laktamase komersial. Kondisi (dosis dan perlakuan) enzim optimum adalah pada dosis dua kali resep yang tertera pada label kemasan botol emzim -Laktamase komersial dengan waktu inkubasi 30 menit. 030 Sugiyanto; Wedhanto, Sonny; Sudiyanto, Tonny. 2007. Pembuatan Peta Isocrone untuk Menentukan waktu Tempuh Perjalanan dalam Kota pada Jam Sibuk di Malang

Kata-kata kunci: peta isocrone, waktu tempuh, kota Malang

Penelitian bertujuan untuk pemetaan waktu tempuh dari tiga terminal di Malang menuju alun-alun sebagai pusat kota. Sifat penelitian: deskriptif, hasil akhir berupa peta kesamaan waktu tempuh (Isocrone) jalur lalu lintas dari tiga buah terminal di Kota Malang menuju ke alun-alun kota dan sebaliknya. Peta jaringan jalan diperoleh dari digitasi Peta Rupa Bumi, pengukuran koordinat jalur lalu lintas menggunakan GPS tipe navigasi yang dilakukan setiap lima menit menggunakan sepeda motor dengan kecepatan 25 sampai 30 km/jam. Pengukuran dari terminal ke alun-alun pada jam 06.30 sampai 08.30, dan dari alun-alun ke terminal pada jam 15.30 sampai 17.00 WIB. Pengolahan data menggunakan perangkat lunak Autocad Map dan Surfer. Hasil: (1) pada jam 06.30 sampai 08.30 waktu tempuh dari terminal ke alunalun berkisar antara 24 sampai 33 menit; (2) pada jam 15.30 sampai 17.00 waktu tempuh dari alun-alun ke terminal berkisar antara 25 sampai 35 menit; dan (3) titik potensi kemacetan terutama menjelang masuk terminal. 031 Sukarni; Nauri, Imam Muda; Sumarli. 2007. Pengaruh Konsentrasi Pasir dan Laju Regangan terhadap Tegangan Geser, Viskositas Nyata dan Koevisien Gesek dari Aliran Dua Fase Pasir Besi-Air pada 0 Pipa Belokan 90

Kata-kata kunci: konsentrasi pasir, laju regangan, tegangan geser, viskositas nyata,koefisien gesek, pipa belokan

24

Abstrak Hasil Penelitian

Tujuan dari penelitian ini adalah untuk mengetahui pengaruh konsentrasi pasir dan laju regangan terhadap tegangan geser,viskositas nyata dan koefisien gesek dari aliran dua fase pasir besi-air pada pipa 0 belokan 90 . 0 Penelitian dilakukan pada pipa belokan 90 dengan jari-jari kelengkungan 0,96 m, diameter dalam 0,0387 m dan panjang 1,5 m. Pasir besi 3 yang digunakan memiliki densitas 4445 kg/m ,dengan konsentrasi berat 4%,6%,9% dan 13%.Fluida pembawa yang digunakan adalah air. Hasil penelitian menunjukkan bahwa penambahan partikel pasir besi pada fluida pembawa menyebabkan kenaikan terhadap tegangan 0 gesek,fiskositas nyata dan koefisien gesek pada pipa belokan 90 . Semakin tinggi laju regangan mengakibatkan tegangan gerser dan viskositas nyata 0 pada pipa belokan 90 semakin naik. Pada daerah laju regangan antara 200 -1 -1 s sampai dengan 365 s kenaikan laju regangan menyebabkan faktor -1 gesek semakin tinggi. Sedangkan pada laju regangan di atas 365 s faktor gesek terus mengalami penurunan. 032 Hariadi, Kusuma; Muslihati. 2007. Analisis Pelaksanaan PPL BK Jurusan BKP

Kata-kata kunci: PPL, jurusan BK

Program pengalaman lapangan merupakan kegiatan intrakurikuler, kegiatan ini merupakan puncak dari pengalaman belajar teori dan praktik mahasiswa bagi penyiapan konselor profesional. Di dalam program pendidikan konselor, PPL-BK meliputi semua kegiatan kurikuler yang harus dilakukan mahasiswa calon konselor sebagai latihan untuk menerapkan teori yang diperoleh dalam realitas pekerjaan konselor pendidikan. Setelah menyelesaikan kegiatan PPL, mahasiswa diharapkan dapat mengembangkan dan mengintegrasikan aspek pengetahuan, keterampilan, dan sikap yang berkaitan dengan pekerjaan konselor (Petunjuk Pelaksanaan PPL-BK, 2005). Berkaitan dengan paparan diatas, penelitian ini bertujuan untuk mengetahui: (1) persepsi mahasiswa, dosen dan konselor pamong mengenai pelaksanaan PPL I dan PPL II BK jurusan BKP (2) pengalaman belajar dan kemampuan mahasiswa prodi BK jurusan BKP dalam pelaksanaan PPL I dan II. Berdasarkan tujuan tersebut, maka penelitian dirancang dalam bentuk deskriptif evaluatif. Sumber data penelitian yaitu mahasiswa peserta PPL BK tahun 2007, sebagian dosen-dosen pembimbing dan konselor pamong. PPL II merupakan kelanjutan dari PPL I. Sekolah mitra yang telah menjalin kerjasama dengan jurusan BKP. Terdapat 13 sekolah mitra yang

Edisi ke-27 Tahun 2008

25

bersedia tempat pelaksanaan PPL II mahasiswa BKP. Pada tahun akademik 2006/2007 PPL II berlangsung mulai bulan Juli 2007 hingga bulan Desember 2007. Selama itu mahasiswa hadir setiap hari di sekolah Dalam proses PPL, mahasiswa akan menjalankan tugas-tugas sebagai calon konselor. Mereka berhadapan dengan pengelolaan administrasi program BK, membantu siswa lewat kegiatan konseling. Setiap peserta PPL II wajib melaporkan kegiatan konseling yang mereka lakukan dengan 8 (delapan) orang klien. Tugas lainnya adalah pengumpulan dan pengolahan data diri siswa. Tugas tersebut biasanya dilakukan pada kelas-kelas binaan. Setiap mahasiswa diberi satu kelas binaan. Kelas tersebut menjadi laboratorium mahasiswa dalam memberikan layanan pembelajaran, layanan informasi lewat ceramah dan tayangan, dan melakukan bimbingan kelompok. Beberapa kesimpulan dapat diperoleh yaitu: pelaksanaan PPL I dan II dapat dikategorikan efektif dan berfungsi meningkatkan kompetensi calon konselor namun pelaksanaan belum cukup efisien khususnya pada PPL I. Di samping itu PPL I perlu ditingkatkan kualitas pelaksanaan karena menjadi program penyiapan PPL II, materi PPL I juga perlu dikembangkan sesuai tuntutan PPL II. Sedangkan pandangan mahasiswa mengenai PPL II cukup positif, mereka merasa mendapatkan pengalaman belajar meski terkadang merasakan adanya tuntutan penyelesaian tugas rutin administrasi BK dari konselor pamong. Dalam pandangan konselor pamong, pelaksanaan PPL I sebaiknya melibatkan sebagian konselor pamong sebagai nara sumber dan durasi waktu pelaksanaan PPL II dirasakan kurang memadai karena banyak moment layanan bimbingan yang tidak diikuti oleh mahasiswa seperti layanan orientasi dan layanan penempatan dan penyaluran. Secara umum PPL I dan II dapat memberikan pengalaman belajar yang berharga bagi Peserta PPL, khususnya di PPL II. Namun tuntutan konselor pamong dirasakan peserta dapat memperlambat proses penyelesaian tagihan dari dosen dan penyelenggara PPL. Proses PPL II dirasakan mahasiswa telah memberikan pengalaman berharga sebagai calon konselor. Implikasi penelitian ini diantaranya saran pada pihak (1) UPTPPL agar memberikan waktu yang lebih lama bagi prodi BK jurusan BKP dalam pelaksanaan PPL II mengingat ada pengalaman belajar yang terlewatkan apabila hanya dilaksanakan selama empat bulan; (2) Jurusan agar peran konselor pamong dapat ditingkatkan dengan melibatkan mereka dalam pemberian materi pada PPL I demikian juga pola manajemen PPL I; (3) Konselor pamong agar memberikan pengalaman belajar yang komprehensif pada mahasiswa dengan melibatkan mereka dalam semua program BK di sekolah secara tulus dan utuh; (4) Peserta agar lebih disiplin, santun dan termotivasi untuk mendapatkan pelajaran dan pengalaman berharga selama

26

Abstrak Hasil Penelitian

PPL I dan II sedangkan; dan (5) Dosen pembimbing, agar selalu mendampingi mahasiswa dalam setiap kegiatan. 033 Maisyaroh; Timan, Agus; Sumarsono, R. Bambang. 2007. Pemecahan Masalah dalam Penyusunan Skripsi Mahasiswa dan Tindaklanjutnya di Jurusan Administrasi Pendidikan Fakultas Ilmu Pendidikan Universitas Negeri Malang

Kata-kata kunci: masalah, penyusunan, skripsi

Permasalahan serius yang dihadapi Jurusan Administrasi Pendidikan antara lain lama studi mahasiswa rata-rata lebih dari sembilan semester. Penyebab utama lama studi ini terletak pada waktu penyelesaian skripsi. Skripsi yang bobotnya 6 sks mahasiswa mampu menyelesaikan dalam waktu yang relatif lama, yaitu rata-rata 2,1 semester. Hal ini diduga disebabkan oleh kemampuan dan motivasi mahasiswa yang rendah dalam menulis skripsi, kemampuan mahasiswa untuk menyesuaikan diri dengan irama pembimbing, kemampuan dosen untuk mengikuti irama dan kemampuan mahasiswa, kurang teralokasikannya waktu dosen untuk membimbing. Adapun yang menjadi tujuan dalam penelitian ini untuk mengetahui ragam hambatan yang dihadapi mahasiswa dalam penulisan skripsi, untuk mengetahui upaya yang dilakukan dalam mengatasi hambatan yang dihadapi oleh mahasiswa dalam penulisan skripsi, untuk mengetahui bentuk kegiatan yang perlu dilakukan Jurusan Administrasi Pendidikan FIP Universitas Negeri Malang. Penelitian ini menggunakan rancangan penelitian deskriptif yang berusaha untuk menggali data, mendeskripsikan dan menganalisisnya sehingga dapat menjawab permasalahan pokok penelitian. Populasi dalam penelitian ini adalah mahasiswa Jurusan Administrasi Pendidikan FIP UM yang memprogram Skripsi Semester Gasal 2007/2008 sejumlah 58 orang dan dosen Jurusan Administrasi Pendidikan yang berjumlah 18 orang. Keseluruhan populasi dijadikan subjek penelitian, jadi tidak mengambil sampel penelitian. Akan tetapi karena keterbatasan waktu maka sampel yang terkumpul sebanyak 50 responden. Teknik pengumpulan data yang digunakan yaitu angket, pedoman wawancara dan dokumentasi. Analisis dalam penelitian ini menggunakan statistik deskriptif berupa persentase, kemudian dilengkapi dengan penyimpulan terhadap pendapat responden. Beberapa kesimpulan dalam penelitian ini, yaitu: (1) ragam hambatan yang dihadapi mahasiswa dalam penulisan skripsi:kesulitan dalam menentukan judul penelitian, mencari sumber pustaka yang relevan dengan judul

Edisi ke-27 Tahun 2008

27

penelitian, membuat instrumen penelitian, menentukan teknik analisis data, menganalisis data, menguji hipotesis penelitian, menyusun narasi kajian pustaka, menentukan rancangan penelitian, menentukan populasi dan sampel penelitian, menentukan teknik pengumpulan data, mengumpulkan data, mendeskripsikan data, membahas hasil penelitian. Disamping itu ditemukan juga dosen pembimbing yang kurang memperhatikan minat dan kemampuan mahasiswa, sangat sibuk/sulit untuk ditemui, berbeda ide antara pembimbing I dan II, kurang mengalokasi waktu pembimbingan, tidak adanya tempat khusus untuk pembimbingan skripsi, serta merasa jenuh dalam pembuatan skripsi dan sering sakit dalam mengerjakan skripsi; (2) upaya yang dilakukan jurusan untuk mengatasi hambatan yang dihadapi mahasiswa dalam penulisan skripsi, yaitu Jurusan perlu merekap judu-judul l skripsi, Jurusan perlu menambah koleksi bahan pustaka di laboratorium, peningkatan intensitas perkuliahan metodologi penelitian kuantitatif, peningkatan intensitas perkuliahan metodologi penelitian kualitatif, peningkatan intensitas perkuliahan seminar proposal skripsi. Dosen pembimbing perlu memahami minat dan kemampuan mahasiswa, dosen pembimbing I dan II perlu meningkatkan koordinasi dalam proses pembimbingan. Jurusan perlu membuat jadwal bimbingan skripsi berdasarkan kesepakatan antara dosen dan mahasiswa sereta perlunya saling menaati kesepakatan yang telah ditentukan; dan (3) tindak lanjut kegiatan yang perlu ditentukan Jurusan AP, yaitu Jurusan AP perlu menentukan kebijakan mikro di tingkat jurusan berupa: (a) intensitas perkuliahan perlu ditingkatkan dengan melengkapi berbagai media dan sumber pustaka yang dibutuhkan mahasiswa dan dosen pembina matakuliah yang berhubungan langsung dengan penulisan skripsi; (b) Monitoring permasalahan mahasiswa perlu dilakukan dengan menyediakan format permasalahan yang dihadapi mahasiswa dan format pemecahan masalahnya; (c) Jurusan dan Fakultas perlu menyediakan tempat khusus untuk pembimbingan skripsi; dan (d) Jurusan dan Fakultas membuat pedoman pengelolaan dan pembimbingan skripsi dengan alur yang jelas. Saran dan rekomendasi yang disampaikan, yaitu Jurusan Administrasi Pendidikan hendaknya menyelenggarakan perkuliahan yang berkaitan dengan penulisan skripsi secara intensif dan memperhatikan ketuntasan belajar mahasiswa, Jurusan Administrasi Pendidikan hendaknya meningkatkan seminar kolegial dengan tema keberhasilan pembimbingan skripsi mahasiswa, Fakultas hendaknya menyediakan tempat pembimbingan sehingga dosen dan mahasiswa tidak kesuliatan menentukan kegiatan pembimbingan.

28

Abstrak Hasil Penelitian

034 Mardianto; Adi, Sapto; Suprivadi. 2007. Bimbingan Kelompok oleh JIK untuk Meningkatkan Efisiensi Penulisan dan Penjelasan Matakuliah Skripsi Mahasiswa JIK FIP UM

Kata-kata kunci: Jurusan Ilmu Keolahragaan, skripsi

Syarat lulus program Sarjana Strata Satu (S1) Jurusan Ilmu Keolahragaan (JlK) FIP UM salah satunya adalah harus lulus skripsi. Model layanan bimbingan skripsi yang dilakukan UM adalah mahasiswa langsung berkosultasi dengan dosen pembimbing. Sebagian kecil mahasiswa dapat menyelesaikan skripsi dalam waktu kurang dari dua semester. Sisanya, memerlukan waktu lebih dari dua semester. Hal itu mengindikasikan, bahwa layanan skripsi belum berjalan optimal. Ada berbagai sebab, antara lain dapat bersumber dari mahasiswa, dan dapat pula bersumber dari dosen pembimbing. Agar layanan skripsi berjalan lancar, maka diperhatikan alternatif, yaitu melalui bimbingan kelompok. Untuk meningkatkan layanan skripsi perlu dilakukan penelitian pengembangan. Subyek pengembangan adalah mahasiswa pemrogram skripsi tahun 2006/ 2007. Hasil penelitian, menunjukkan bahwa layanan skripsi berkelompok perlu dilakukan. Mampu melakukan penelitian dan mengaplikasikan hasil-hasil penelitian serta menyusun laporan dalam bentuk skripsi memerlukan berbagail keterampilan belajar yang komprehensif dan intergratif. Keterampilan belajar berbahasa baik tulis maupun lisan sekaligus keterampilan berkomunikasinya, keterampilan menemukan ide dan menuangkan ide yang penting dalam memecahkan masalah melalui kegiatan penelitian. Karena itu, untuk menempuh matakuliah skripsi, ada prasyarat harus lulus bahasa indonesia Keilmuan, Metode Penelitian, Statistika, Tes dan Pengukuran; dan Penguasaan Teknik Penulisan Karya Ilmiah; serta Penguasaan bidang keilmuan utama maupun pendukungnya, yang tersebar dalam berbagai matakuliah pada program studi. Pola pembimbingan yang langsung antara mahasiswa dan dosen pembimbing, pada sisi tententu positif, karena mahasiswa yang telah mempersiapkan diri secara baik dapat segera memperoleh layanan dan cepat menyelesaikan skripsinya tanpa jalur birokrasi yang panjang. Tetapi, sebagian mahasiswa yang lain dan jumlahnya pada kelompok ini lebih banyak; sering kali menemui hambatan, seperti yang telah dijelaskan di depan. Hambatan yang paling tinggi adalah mencari sumber pustaka, membuat instrumen penelitian, menentukan teknik analisis data, dan menguji hipotesis; hambatan lain; menentukan judul penelitian, penyusunan narasi kajian kepustakaan, menentukan rancangan penelitian, menentukan

Edisi ke-27 Tahun 2008

29

populasi dan sampel penilaian, menentukan teknik pengumpulan data, mengumpulkan data, mendiskripsikan data, membahas hasil penelitian, merasa jenuh dan sakit mengerjakan skripsi, pembimbing kurang memperhatikan minat dan kemampuan mahasiswa, ide pembimbing I dan II berbeda sehingga mahasiswa bingung, dan tempat dan waktu pembimbingan tidak jelas (berubah-ubah). Akibatnya angka penyelesaian skripsi dengan waktu lebih dari dua semester sangat besar pada Jurusan ilmu Keolahragaan (JIK). Atas dasar uraian tersebut di depan, maka perlu upaya altematif, seperti pembimbingan skripsi secara kelompok oleh JIK. Hasil penelitian antara lain; pembingan kelompok perlu dilakukan, sejak awall semester - tengah semester - akhir semester, oleh JIK, utamanya satgas skripsi JIK, sekurang-kurang sepuluh kali tatap muka, dengan materi antara lain; (a) strategi dan teknik menghadapi dosen pembimbing, mencari sumber pustaka dan menyusun narasi kajian pustaka; (b) pengayaan dan mereviu metode penelitian, statistik, dan PPKI. Bimbingan kelompok perlu dilakukan karena individu merasa terlibat dalam kelompok, merasa senasip, tempat untuk saling terbuka hati dan pikiran, memperoleh aspirasi dan inspirasi dari teman lain. Saran, JIK perlu segera melakukan implementasi hasil penelitian ini dengan disertai penelitian tindakan kelas (PTK) sehingga model pembimbingan kelompok dapat diuji tingkat efektivitasnya dalam layanan penyelesaian matakuliah skripsi. 035 Samawi, Ahmad; Akbar, Sa'dun; Sutarno. 2007. Pemetaan Skripsi Mahasiswa Jurusan Kependidikan Sekolah Dasar dan Prasekolah (KSDP) FIP Universitas Negeri Malang

Kata-kata kunci: penelitian pemetaan, skripsi mahasiswa S1 PGSD

Penelitian ini bertujuan untuk mendesknipsikan; (1) pemetaan skripsii mahasiswa Jurusan Kependidikan Sekolah Dasar dan Prasekolah, (2) kesulitan yang diliadapi mahasiswa dalam menyelesaikan skripsi, dan (3) cara-cara yang dilakukan mahasiswa dalam mengatasi kesulitan penulisan skripsi. Penelitian ini dilakukan dengan menggunakan metode deskriptif dengan rancangin deskriptif. Subjek penelitian adalah skripsi mahasiswa S1 PGSD yang sudah menyelesaikan skripsinya. Data dikumpulkan dengan menggunakan instrumen dokumentasi, dan angket. Teknik analiss yang digunakan dalam penelitian ini adalah analisis content.

30

Abstrak Hasil Penelitian

Hasil penelitian ini dapat dikemukakan sebagai berikut. (1) sebagian rnahasiswa (50,93) melakukan penelitian tindakan kelas yang diarahkan pada bidang studi di SD dan (2) Kesulitan yang dihadapi mahasiswa dalam penulisan skripsi adalah penyusunan proposal terutama latar belakang penelitian dan perbedaan pendapat dengan dosen pembimbing serta pengumpulan data dan analisis data (72%). Di samping itu mahasiswa juga mengalami kesulitan dalam mengumpulkan data. Untuk mengatasi masalah tersebut mahasiswa mencoba dengan menuruti pendapat dosen pembimbing dan pinjam buku teman (56%) dan meminjam buku teman (28%) dan berkomunikasi dengan dosennya(14 %). Dari hasil pengumpulan data dan analisis data dapat disimpulkan sebagaii berikut; (1) Penulisan skripsi mahasiswa S1 PGSD FIP UM dapat dipetakan pada penelitian tindakan kelas dan non PTK serta sesuai bidang studi yang diajarkan di SD; (2) Kesulitan yang dihadapi mahasiswa S1 PGSD dalam menulis skripsi dimulai dari rnenyusun proposal dalam menyusun kajian kepustakaan, pengumpulan dan analisis data, dan serta berkomunikasi dengan dosen pembimbingnya; dan (3) Cara yang dilakukan mahasiswa S1 PGSD untuk mengatasi kesulitan dalam menulis skripsinya adalah dengan menuruti pendapat dosen pembimbing dan meminjam buku temannya. Disarankan untuk melakukan penelitian sebagai benikut. (1) perlu penelitian lebih lanjut tentang kemampuan meneliti mahasiswa S1 PGSD; (2) perlu dilakuan meta analisis penelitian tentang pemanfaatan hasil penelitian di lembaga penelitian bagi penulisan skripsi mahasiswa; dan (3) perlu dilakukan penelitian lebih lanjut peran dosen pembimbing dalam pembimbingan skripsi. 036 Maryaeni; Arifin, Bustanul; Suhenjanto, Indra. 2007. Pengembangan Profil Jurusan Sastra Indonesia dalam Bentuk Compac Disc Intraktif sebagai Sarana Evaluasi Diri dan Promosi

Kata-kata kunci: profil Jurusan, evaluasi diri, promosi, CD lnteraktif

Jurusan Sastra Indonesia (JSI) merupakan salah satu jurusan yang tertua di Universitas Negeri Malang (UM). Jurusan ini terdiri tahun 1954 bersamaan dengan berdirinya Perguruan Tinggi Pendidikan Guru (PTPG) Malang. Perjalanan JSI yang panjang tersebut diikuti dengan perkembangan jurusan dengan berbagai aspeknya antara lain: jumlah mahasiswa, jurnlah dosen, perluasan program studi dengan kurikulum yang telah disesuaikan dengan tuntutan perkembangan masyarakat, dan alumni yang tersebar dii

Edisi ke-27 Tahun 2008

31

seluruh Indonesia. Namun demikian perlu diakui bahwa perkembangan JSI dengan segala potensi yang telah dimiliki belum diketahui secara luas oleh masyarakat. Kehadiran JSI, sudah semestinya sesegera mungkin diketahuii oleh pihak-pihak yang dapat memanfaatkan lulusannya.. Selama ini JSI FS UM belum memiliki media yang dapat memperkenalkan keberadaan JSI FS UM ke masyarakat. Oleh karena itu, perlu dikembangkan media yang berisi Profil JSI FS UM sebagai Sarana Evaluasi Diri dan Promosi. Tujuan dan pengembangan media ini ialah tersusunnya profil FSI FS UM dalarn bentuk leaflet yang sekurang-kurang memuat visi, misi, tujuan, program studi, kurikulum, perkembangan mahasiswa dan dosen, alumni, serta sarana prasarana dalam bentuk leaflet dalam bentuk CD. Penelitian ini dilakukan untuk menemukan data-data terbaru tentang lembaga dalam rangka menentukan strategi pengembangan di masa mendatang. Penelitian ini termasuk penelitian kualitatif karena karakter penelitian ini adalah mengungkap dan menggunakan data-data yang bersifat kualitatif antara lain dokumen tertulis (kurikulum, data dosen, data mahasiswa, daftar sarana dan prasarana pendidikan, daftar alumnus) dan dokumen tidak tertulis (foto kegiatan pembelajaran foto dosen, foto kegiatan mahasiswa ). Proses pengumpulan data menggunakan teknik dokumentasi. Data yang terkumpul kernudian dianalisis dengan analisis deskriptif naratif. Hasil penelitian yang tertuang dalam CD interaktif profil JSI adalah; (1) sejarah JSI dan tahun 1954 sampai dengan 2007; (2) visi dan misi JSI; dan (3) tujuan JSI; (4) Program Studi yang ada di JSI; (5) visi dan misi pada masing-masing program studi; (6) tujuan pada masing-masing program studi; (7) kompetensii dan kewenangan lulusan masing-masing progrm studi yang ada di JSI; (8) fleksibilitas gelar ganda; (9) program pilihan; (10) tenaga pengajar 151; dan (11) sarana dan prasarana yang dimiliki 151. Hasil penelitian diharapkan bermanfat bagi: (1) calon mahasiswa baru untuk memperoleh informasi yang lengkap tentang Jurusan Sastra Indonesia; (2) institusi pemenintah maupun nonpemenintah; dan (3) Fakultas Sastra Universitas Negeri Malang sebagaii sarana melengkapi data yang dapat digunakan sebagai dasar untuk menentukan berbagai kebijakan yang tepat. 037 Widiati, Utami. 2007. Pengembangan Profil Jurusan Sastra Inggris sebagai Sarana Evaluasi Diri dan Promosi

Kata-kata kunci: profil Jurusan Sastra Inggris, evaluasi diri, promosi

32

Abstrak Hasil Penelitian

Jurusan Sastra Inggris merupakan salah satu jurusan dalam Fakultas Sastra, Universitas Negeri Malang. Hingga saat ini, Jurusan memiliki dua program studi yaitu kependidikan (Program Studi Pendidikan Bahasa Inggris) dan non-kependidikan (Program Studi Sastra Inggris) yang dibagi berdasarkan dua dua kepeminatan: Sastra dan Linguistik Inggris. Sebagai sebuah institusi yang bergerak dalam bidang pendidikan adalah mutlak bagi Jurusan untuk tidak hanya mempertahankan dan mengembangkan kinerja institusinya, melainkan juga meningkatkan kompetensi dan profesionalisme institusi secara utuh. Berdasarkan kemutlakan tersebut, penelitian ini dilaksanakan untuk menyusun profil Jurusan Sastra Inggris. Profil ini digunakan sebagai salah satu landas tumpu bagi Jurusan untuk bersikap dan bertindak dalam menentukan langkah ke depan untuk menyejajari kompetensi mulai dari tingkat lokal hingga global. Profil Jurusan dilihat dari tiga komponen utama: masukan, proses, dan luaran. Penelitian ini dilakukan dengan menggunakan rancangan penelitian deskriptif yang menggunakan analisis dokumentasi. Sumber data yang digunakn dalam penelitian ini adalah dokumen-dokumen dan catatan-catatan yang dimiliki institusi, baik pada tingkat jurusan, fakultas maupun universitas. Teknik pengumpulan data dilakukan dengan mengakses langsung data-data tersebut kepada pihak-pihak yang terkait. Analisis data yang masuk dipilah dan diklasifikasikan sesuai dengan urutan pembahasan dalam laporan akhir penelitian. Hasil akhir penelitian ini memberikan gambaran bahwa dalam kurun satu paruh periode (2001-2005), kinerja Jurusan Sastra Inggris cenderung negatif. 038 Khasairi, Moh.; Muhaiban; Ainin, Moh; Mahliatussikah, Hanik. 2007. Pengembangan Profil Program Studi Pendidikan Babasa Arab Berbasis Evaluasi Diri dalam Bentuk CD lnteraktif sebagai Sarana Promosi

Kata-kata kunci: profil Jurusan, evaluasi diri, promosi, CD lnteraktif

Promosi merupakan kegiatan yang seharusnya dilakukan oleh perguruan tinggi (PT). Dengan promosi yang intensif diharapkan semakin banyak calon mahasiswa yang mendaftarkan din, persaingan semakin ketat, dan kualitas input meningkat. Promosi memiliki posisi yang strategis, oleh karena itu harus dirancang dengan baik dengan basis yang baik juga. Evaluasi diri yang dikembangkan oleh Dirjen Dikti merupakan instrumen

Edisi ke-27 Tahun 2008

33

yang memadai untuk dijadikan dasar dalam penentuan kebijakan. Atas dasar itulah sarana promosii yang dikembangkan dalam penelitian ini didasarkan pada hasil evaluasi diri yang instrumennya dikembangkan oleh Dirjen Dikti. Rancangan penelitian yang digunakan adalah rancangan deskriptif dan pengembangan. Rancangan deskniptif digunakan untuk menyusun hasil evaluasii diri, sedangkan rancangan pengembangan digunakan untuk pembuatan CD interaktif dalam rangka membuat sarana promosi. Data penelitian dikumpulkan dan sumber data yang berupa dokumen-dokumen resmi mengenai PSPBS JSA FS UM selama tiga tahun terakhir. Hasil penelitian selanjutnya dipilah dan dipilih yang sesuai untuk bahan pengembangan profil PSPBA dalam bentuk CD. Secara umum hasil penelitian meliputi: (1) jati did PSPBA sejarah, visi, misi, dan tujuan; (2) profil kemahasiswaan sistem rekrutmen dan seleksi calon mahasiswa, kualitas akademik, sosio-ekonomi, kemandirian, kreativitas, kegiatan ekstra-kurikuler, bantuan tutorial akademik, informasi dan bimbingan karir, konseling pribadi dan sosial; (3) profil tenaga akademik: sistem rekrutmen dan seleksi dosen, pengelolaan dosen, kualifikasi, pengalaman, rasio dosen mahasiswa, karya akademik, peraturan kerja dan kode etik, pengembangan staf; (4) profil kurikulum: kesesuaian dengan visi, misi, sasaran, dan tujuan relevansi dengan tuntutan dan kebutuhan stake holders; struktur dan isi kurikulum; kompetensi dan etika lulusan yang diharapkan; kunkulum lokal; matakuliah pilihan; (5) profll sarana dan prasarana akademik: Laboratonium bahasa, perpustakaan, bengkel kaligrafi, self access center, ruang kuliah, media pembelajaran; (6) profil pendanaan: sumber dana, sistem alokasi dana, pengelolaan dan akuntabilitas penggunaan dana, keberlanjutan pengadaan dan pemanfaatan dana; (7) profil tata pamong: sisteni nilai, sistem pengelolaan, sistem kepemimpinan, sistem pengalihan tugas (deputizing), perencanaan program jangka panjang; (8) profil pengelolaan program: efisiensi dan efektivitas kepemimpinan, evaluasi program dan pelacakan lulusan, kerjasama dan kemitraan; (9) profil pembelajaran: kompetensi yang diharapkan, strategi pembelajaran, media pembelajaran, keterlibatan mahasiswa, penilaian, bimbingan skripsi; (10) profil suasana akademik: rancangan pengembangan, sarana pendukung interaksi, kualitas dan kuantitas interaksi, keterlibatan civitas akademika, pengembangan kepribadian ilmiah; (11) profil sistem informasi: rancangan pengembangan, kecukupan & kesesuaian sumber daya dan sarana, efisiensi & efektivitas pemanfaatan; (12) profil sistem jaminan mutu: keberadaan unit jaminan mutu, pengelolaan mutu, hubungan dengan penjaminan mutu, dampak proses penjaminan mutu, metodologi baku mutu, pengembangan dan penilaian, evaluasi internal, pemanfaatan hasil evaluasi, kerjasama dan

34

Abstrak Hasil Penelitian

kemitraan; (13) profil karya ilmiah: kualitas, produktivitas, relevansi sasaran dan efisiensi pemanfaatan dana penelitian dan pengabdian (P2M); agenda, keberlanjutan, diseminasi hasil P2M, kegiatan P2M bersama dosen dan mahasiswa, kuantitas dan kualitas kegiatan P2M dan publikasi ilmiah, hubungan antara tri dharma perguruan tinggi, hubungan kerjasama dan kemitraan penelitian; kualitas dan kurun waktu penyelesaian skripsi; publikasi hasil penelitian, karya inovatif, dan rangkuman tesis; produk prodi, berupa model-model, hak paten, hasil pengembangan prosedur kenja, produk fisik sebagai hasil penelitian; dan (14) lulusan: hasil pembelajaran, kepuasan masyarakat dan keberlanjutannya. 039 Retnantiti, Sawitri; Hidayat, Edy; Indriwardhani, Sri Prameswari; Kurniawan, Deddy. 2007. Pengembangan Profil Jurusan Sastra Jerman Berbasis Evaluasi Diri dalam Bentuk CD Interaktif sebagai Sarana Promosi

Kata-kata kunci: profil Jurusan, evaluasi diri, promosi, CD lnteraktifi

Program-program yang telah dilaksanakan oleh civitas akademika Jurusan Sastra Jerman (JSJ) senantiasa dimonitoring JSJ dalam bentuk pangkalan data (Data Base). Pangkalan data diperlukan untuk menyusun evaluasi diri, baik sebagai sarana refleksi diri untuk perbaikan kinerja jurusan ke depan, maupun untuk persiapan akreditasi jurusan di tahun 2009 nanti. Sarana evaluasi diri sifatnya untuk kebutuhan ke dalam jurusan, sedangkan kebutuhan ke luar jurusan lebih kearah kebutuhan akan promosi dan selama ini belum pernah dilakukan. Untuk itu program studi Pendidikan Bahasa Jerman JSJ sangat perlu mengembangkan Profil Jurusan dalam bentuk CD (Compact Disc) Interaktif sebagai salah satu bentuk sarana promosi. Tujuan penelitian ini adalah untuk mengembangkan profil Jurusan Sastra Jerman berbasis evaluasi diri (dengan analisis SWOT) dan membuat CD interaktif (dan Strength dan Oppurtunity) sebagai sarana promosi. Penelitian ini dilakukan dengan dua macam pendekatan, yaitu pendekatan kualitatif dan pendekatan pengembangan. Rancangan yang digunakan juga dua macam rancangan, yaitu rancangan deskriptif dan rancangan pengembangan. Sumber data penelitian ini adalah data dokumen Jurusan 3 (tiga) tahun terakhir semester gasal (2004/2005) -- semester genap (2006/2007). Data tersebut menjaring informasi tentang komponenkomponen Profil Jurusan berupa; (1) identitas program studi Pendidikan Bahasa Jerman JSJ; (2) data tenaga kemahasiswaan; (3) data tenaga akademik; (4) sarana dan prasarana belajar mahasiswa; (5) struktur

Edisi ke-27 Tahun 2008

35

kurikulum JSJ; (6) sistem pendanaan; (7) tata pamong; (8) pengelolaan lembaga; (9) proses pembelajaran; (10) suasana akademik; (11) sistem informasi; (12) sistem penjamin mutu; (13) lulusan; dan (14) penelitian publikasi ilmiah, skripsi, dan pengabdian kepada masyarakat. Data-data tersebut dianalisis sebagai bahan evaluasi diri dan dari hasil analisis SWOT, untuk kekuatan (Strength) dan peluang (Oppurtunity) disajikan dalam bentuk CD lnteraktif dengan program Publishe. Adapun rumah-rumah yang masuk dalam menu utama CD interaktif adalah sebagai berikut; (1) Tentang Jurusan (Sejarah, visi, misi, tujuan; Struktur Kurikulum), (2) Kemahasiswaan (Prestasi akademik, Kegiatan Himpunan Mahasiswa Jurusan (HMJ), Unit Kegiatan Mahasiswa (UKM), Beasiswa, Kegiatan Praktik Kerja Lapangan (PKL) dan Au-Pair), (3) Fasilitas ( Perpustakaan dan Mediothek, Laboratorium Bahasa dan Komputer), (4) Staf Tenaga Akademik (Biodata 15 orang dosen JSJ), (5) Publikasi Karya ilmiah dan Terjemahan, (6) Alumni, dan (7) Kemitraan. Halaman-halaman CD Interaktif tersebut didesain dengan bingkaii bernuansa warna ungu sesuai dengan ciri khas warna Fakultas Sastra UM dengan tulisan warna hitam dan berlatar belakang suara musik klasik. Untuk melengkapi informasi yang disampaikan disertakan juga foto-foto kegiatan mahasiswa, staf akademik dan sarana prasanana yang dimiliki JSJ serta alamat Jurusan dan Website yang bisa dihubungi. 040 Gede Agung, Dewa Agung; Sayono, Joko; Mashuri; Irawan; Suprapta, Blasius. 2007. Pengembangan Profil Jurusan Sejarah dalam Bentuk Compac Disc Interaktif Sebagai Sarana Evaluasi Diri dan Promosi

Kata-kata kunci: profil Jurusan, evaluasi diri, promosi, CD lnteraktifi

Jurusan Sejarah merupakan salah satu jurusan yang ada sejak awal bersamaan dengan berdirinya Perguruan Tinggi Pendidikan Guru (PTPG) Malang pada tanggal 18 Oktober 1954. PTPG merupakan embrio Institut Keguruan dan IImu Pendidikan (IKIP) Malang yang berdiri tahun 1959. Sejak pertama kali berdirinya, Jurusan Sejarah, telah beberapa kali berganti nama yaitu Sejarah Budaya th.1954 -- 1962, kemudian Sejarah Antropologi th.1672-1975, kemudian pada th.1975-1980 diubah menjadi departemen Sejarah Civic/Hukum. Selanjutnya pada tahun 1980-1984 diubah menjadi Program Studi Sejarah, Jurusan Pendidikan Sejarah th.1984 -- 1997 dan akhirnya menjadi Jurusan Sejarah sejak th.1997 dengan dua program studi yakni Program Studi Pendidikan Sejarah dan Program Studi

36

Abstrak Hasil Penelitian

IImu Sejarah. Program studi Ilmu Sejarah dibuka th.2005-2006 berdasarkan surat ijin DKTI no.2288/D/T/2003 tanggal 5 September 2003. Sejak pertama kali berdirinya, Jurusan Sejarah, telah beberapa kali berganti nama yaitu Sejarah Budaya th.1954--1962, kemudian Sejarah Antropologi th.1672--1975, kemudian pada th.1975-1980 diubah menjadi departemen Sejarah Civic/Hukum. Selanjutnya pada tahun 1980-1984 diubah menjadi Program Studi Sejarah, Jurusan Pendidikan Sejarah th.1984-1997 dan akhirnya menjadi Jurusan Sejarah sejak th.1997 dengan dua program studi yakni; Program Studi Pendidikan Sejarah dan Program Studi ilmu Sejarah. Program studi ilmu Sejarah dibuka th.2005-2006 berdasarkan surat ijin DKTI no.2288/D/T/2003 tanggal 5 September 2003. Jurusan sejarah dipimpin oleh seorang ketua Jurusan dan dibantu oleh seorang sekretaris Jurusan. Komposisi tenaga dosen dilihat dan pendidikannya menunjjukkan 2 orang bergelar doktor, 20 orang bergelar magister, dan 4 orang bergelar sarjana. Dan segi jabatan fungsional, menunjukkan 10 orang lektor kepala, 12 orang iektor dan 3 orang asisten ahli. Sedangkan dari segi kepangkatan menunjukkanl orang golongan IVc, 4 orang golongan IVb, 5 orang golongan IVa, 8 orang golongan IIId, 4 orang golongan IIIb, dan 1 orang golongan IIIa. Dalam melaksanakan belajar mengajar Juruan Sejarah dilengkapi dengan laboratorium sejarah. Laboratorium Sejarah FS UM memiliki berbagai sarana yang dapat menunjang kegiatan belajar mengajar. Koleksi yang dimiliki berupa artefak, relik, bagan, duplikat, maket, vandel dan barang etnografi. Perangkat keras yang dimiliki berupa seperangkat komputer, laptop, LCD, scaner, wearless, kamera, handycam, megaphone, dll. Invetaris barang-barang yang ada berupa meja, kursi, lemari, dispenser, dll. Perangkat lunak yang dimiliki adalah CD-CD pembelajaran berupa film maupun dokumenter yang menunjang mata kuliah tertentu Sedangkan koleksi buku yang dimiliki adalah buku-buku sejarah, arkeologi, pendidikan, antropologi, sosiologi, politik, dan ilmu-ilmu sosial yang lain. Selain buku yang dimiliki adalah skripsi, tugas akhir, jurnal, malajalah, laporan penelitian pidato lektorat, dll. Semua koleksi tersebut sangat potensial untuk pengembangan ilmu-ilmu sejarah, arkeologi, pendidikan, sosiologi dan antropologi. HMJ Sejarah sebagai organisasi mahasiswa selalu berusaha mewadahi segala aktivitas mahasiswa sejarah. Banyak kegiatan dilakukannya, namun secara tradisi terdapat kegiatan yang selalu dilakukan dari generasi ke generasi. Kegiatan tersebut diantaranya Abhiseka, kegiatan ini dilakukan untuk menyambut mahasiswa baru yang dilakukan dalam bentuk kunjungan situs kesejarahan, bakti situs sekitar Jawa Timur dalam

Edisi ke-27 Tahun 2008

37

waktu 2-3 hari. LMO (Latihan Managemen Organisasi), dilakukan dalam rangka memberikan pembekalan kepada mahasiswa baru tentang kepemimpinan dan organisasi dalam rangka mempersiapkan terjadinya regenerasii kepengurusan dalam HMJ. Glasnov (Gelar Aksi Sepuluh November). Kegiatan inii merupakan puncak dan kegiatan pengurus HMJ dalam tahun tertentu. Dalam Glasnov biasanya terdapat banyak kegiatan karena ini menjelang berakhirnya periode kepengurusan HMJ. Kegiatan tersebut dinantaranya olimpiade sejarah, berbagai macam jenis pertandingan olah raga, kunjungan ke makam pahlawan, pameran kesejarahan dan sebagainya. Seminar, dengan pembicara baik dalam maupun luar Jurusan Sejarah UM. Berbuka puasa bersama, biasanya dilakukan pada saat bulan ramadhan tiba. Untuk jelasnya sebagai contoh kegiatan mahasiawa dapat dilihat pada tabel di bawah ini. Sesuai dengan visi dan misi jurusan sejarah, sarana prasarana pendukung proses belajar mengajar yang mendukung, termasuk program-progam HMJ yang dilaksanakan diharapkan Lulusan S-1. Program Studi Pendidikan Sejarah memiliki kompetensi dan kewenangan utama dalam bidang pendidikan sejarah dan lulusan S-1 Program Studi Ilmu Sejarah diproyeksikan sebagai ahli sejarah/sejarawan peneliti dan penulis di jenjang pendidikan dasar dan menengah. 041 Permadi, Hendro; Rahardjo, Swasono; Wahyuningsih, Sapti; Satyananda, Darmawan. 2007. Peningkatan Kualitas Pelaksanaan PKL bagi Mahasiswa Jurusan Matematika FMIPA UM melalui Pemetaan Kerjasama dengan Industri/Instansi di Malang Raya

Kata-kata kunci: PKL, mahasiswa FMIPA, kerjasama industri/instansi

Praktek Pengalaman Lapangan (PPL) adalah matakuliah yang mengembangkan kompetensi mahasiswa dalam melaksanakan praktek kependidikan dan non-kependidikan agar mahasiswa siap menjadi tenaga profesional dalam bidang keahliannya (Pedoman pendidikan UM 2007). Di jurusan Matematika FMIPA UM, matakuliah PPL untuk prodi non kependidikan diberi nama Praktek Kerja Lapangan (PKL). Mulai kurikulum 2002, PKL bersifat wajib bagi mahasiswa prodi Matematika. PKL dilakukan secara terprogram, terpadu dan terbimbing melalui kegiatan magang di perusahaan/ industri/lembaga yang sesuai dengan keahliannya. Selama ini kegiatan matakuliah PKL belum terprogram secara baik, karena mahasiswa menemui kesulitan dalam mencari tempat untuk PKL, dan kurangnya informasi mengenai instansi/perusahaan/industri/lembaga yang sesuai atau bidang

38

Abstrak Hasil Penelitian

kerja apa yang bisa menerima mahasiswa jurusan Matematika. Hal ini diakibatkan kurangnya kerjasama antara jurusan Matematika dengan pihak luar yang menerima mahasiswa melakukan PKL. Dalam rangka pembenahan pelaksanaan PKL, perlu dilakukan pemetaan mengenai industri/perusahaan/instansi yang menerima mahasiswa PKL, bidang kerja apa yang bisa ditangani mahasiswa Matematika, dan kebijakan apa yang perlu dikeluarkan oleh pihak fakultas atau jurusan. Penelitian dilakukan dengan menyebar angket yang diberikan kepada pihak industri atau instansi yang menerima mahasiswa, dan mahasiswa yang melakukan PKL. Ada sejumlah poin yang ditanyakan di antaranya mengenai prosedur pelaksanaan PKL, hambatan yang ditemui, kemampuan yang sebaiknya dimiliki mahasiswa, jangka waktu pelaksanaan, dan kriteria penilaian. Hasil penelitian menunjukkan bahwa mahasiswa prodi Matematika FMIPA UM mampu melakukan pekerjaan di bidang statistika, pemodelan, penjadwalan proses produksi dan distribusi, otomasi pekerjaan dengan menggunakan software, dan publikasi informasi dalam bentuk website. Selain itu perlu adanya kerjasama yang baik antara pihak industri atau instansi yang bisa menerima mahasiswa PKL dengan pihak fakultas atau jurusan agar mahasiswa bisa menerapkan ilmunya dengan baik, mahasiswa mendapatkan gambaran mengenai dunia kerja, jurusan atau fakultas bisa mendapatkan gambaran mengenai bidang kerja mahasiswa dan kompetensi yang diperlukan, serta membuka wawasan bagi industri mengenai penggunaan ilmu matematika dalam pekerjaan. 042 Retno Widarti, Hayuni; Subandi; Prayitno. 2007. Peningkatan Kualitas Pelaksanaan PKL bagi Mahasiswa Jurusan Kimia FMIPA UM melalui Pemetaan Kerjasama dengan Industri/Instansi di Malang Raya dan Sekitarnya

Kata-kata kunci: PKL, kerjasama industri

Praktek Pengalaman Lapangan (PPL) adalah matakuliah yang mengembangkan kompetensi mahasiswa dalam melaksanakan praktek kependidikan dan non kependidikan agar mahasiswa siap menjadi tenaga professional dalam bidang keahliannya (Pedoman Pendidikan UM 2006). Di Jurusan Kimia FMIPA UM matakuliah PPL untuk program studi non kependidikan diberi nama Praktek Kerja Lapangan (PKL). PKL merupakan matakuliah wajib bagi mahasiswa program studi Kimia di Jurusan Kimia FMIPA UM yang keluar pada semester VIII.

Edisi ke-27 Tahun 2008

39

Penelitian institusional imbal swadaya ini bertujuan mengetahui jenisjenis industri/instansi di Malang Raya dan sekitarnya yang sesuai dengan kebutuhan Praktek Kerja Lapangan mahasiswa program studi Kimia Jurusan Kimia FMIPA UM, dan mengetahui berapa jumlah industri/instansi di Malang Raya dan sekitarnya yang bersedia menerima Praktek Kerja Lapangan mahasiswa program studi Kimia Jurusan Kimia FMIPA UM. Data diperoleh dengan menyebarkan angket dan kunjungan ke beberapa industri yang pernah ditempati PKL mahasiswa program studi Kimia. Telah diidentifikasi jenis-jenis industri/instansi di Malang Raya dan sekitarnya yang sesuai dengan kebutuhan Praktek Kerja Lapangan mahasiswa program studi Kimia Jurusan Kimia FMIPA UM. Kebanyakan industri yang bersedia menampung PKL mahasiswa program studi Kimia adalah di bidang penelitian yang terkait dengan pengujian bahan, pengukuran dan kalibrasi, pengambilan data penelitian beserta interpretasinya, system control dan instrumentasi. Dari hasil penelitian ini direkomendasikan beberapa hal: (1) Penanganan mahasiswa PKL hendaknya dikelola oleh Fakultas dan jurusan, karena PKL sangat terkait dengan karakteristik Jurusan dan waktunya tidak bisa dijadwalkan secara tetap; (2) Perlu dirancang mated pembekalan bagi mahasiswa PKL, misalnya mengenai keselamatan kerja, etos keija didunia industri dan informasi-informasi mengenali karakteristik industri/instansi tempat PKL; dan (3) Perlu diatur proses pembimbingan PKL dan penjadwalan kunjungan ke lokasi PKL oleh pembimbing. 043 Hidayat, Arif; Parno. 2007. Peningkatan Kualitas Pelaksanaan PKL bagi Mahasiswa Jurusan Fisika FMIPA UM melalui Pemetaan Kerjasama dengan Industri/lnstansi di Malang

Kata-kata kunci: PKL, mahasiswa jurusan Fisika, pemetaan, kerjasama industri

Penelitian institusional imbal swadaya ini bertujuan mengetahui jenisjenis industri/instansi di Malang Raya dan sekitarnya yang sesuai dengan kebutuhan Praktek Kerja Lapangan mahasiswa program studi Fisika jurusan Fisika dan mengetahui berapa jumlah industri/instansi di Malang Raya dan sekitarnya yang bersedia menerima Praktek Kerja Lapangan mahasiswa program studi Fisika Jurusan Fisika FMIPA UM. Data diperoleh dengan menyebarkan angket dan kunjungan ke beberapa industri yang pernah ditempati PKL mahasiwa program studi Fisika. Telah diidentifikasi jenis-jenis industri/instansi di Malang Raya dan sekitarnya yang sesuai dengan kebutuhan Praktek Kerja Lapangan mahasiswa program studi Fisika Jurusan Fisika FMIPA UM. Kebanyakan

40

Abstrak Hasil Penelitian

industri yang bersedia menampung PKL mahasiswa program studi Fisika adalah di bidang penelitian yang terkait. dengan pengujian bahan, pengukuran dan kalibrasi, pengambilan data penelitian beserta interpretasinya, sistem kontrol dan instrumentasi. Dari hasil penelitian ini direkomendasikan beberapa hal (1) Penanganan mahasiswa PKL hendaknya dikelola oleh Fakultas dan jurusan, karena PKL sangat terkait dengan karakterisitik Jurusan dan waktunya tidak bisa dijadwalkan secara tetap, (2) Perlu dirancang materi pembekalan bagi mahasiswa PKL, misalnya mengenai keselamatan kerja, etos kerja di dunia industri dan informasi-informasi mengenali karakteristik industri/instansi tempat PKL, dan (3) Perlu diatur proses pembimbingan PKL dan penjadwalan kunjungan ke lokasi PKL oleh pembimbing. 044 Sumarli; Tuwoso; Siswanto; Wahono; Romlie H.M. 2007. Tanggapan Mahasiswa dan Dosen terhadap Pelaksanaan UAS di Jurusan Teknik Mesin Fakultas Teknik Universitas Negeri Malang

Kata-kata kunci: pelaksanaan Ujian Akhir Semester, Teknik Mesin

Evaluasi pembelajaran merupakan salah satu komponen penting dalam sistem pembelajaran. Tujuan dalam penelitian ini adalah untuk mengetahui tanggapan mahasiswa dan dosen Jurusan Teknik Mesin Terhadap pelaksanaan UAS. Sampel penelitian dipilah secara klaster yaitu angkatan 2006, 2005, dan 2004. Masing-masing angkatan diambil satu kelas secara acak. Instrumen dalam penelitian ini adalah kuesioner. Analsisis data dalam penelitian ini adalah teknik analisis deskriptif, yaitu persentase dan disajikan melalui tabel dan grafik distribusi frekuensi. Hasil penelitian menyimpulkan bahwa dosen dan mahasiswa menilai bahwa perlu ada jadwal UAS. Jumlah matakuliah yang diajukan sebaiknya hanya 2 matakuliah. Jadwal UAS diumumkan terlalu dekat dengan waktu UAS. Waktu 100 menit sudah cukup untuk UAS satu matakuliah. Pengawas ujian perlu dilakukan oleh dua orang yaitu dosen dan panitia. Kesesuaian materi dan tingkat kesulitan soal sudah cukup baik. Dosen kurang obyektif dan standartnya belum sama dalam menilai pekerjaan mahasiswa. Satu soal untuk matakuliah yang sama belum dilaksanakan. Disarankan Jadwal UAS sebaiknya diumumkan sebelum kuliah berakhir. Dosen perlu lebih transfaran dan obyektif dalam menilai pekerjaan mahasiswa. Perlu adanya standart penilaian sehingga siapapun dosennya standart nilainya sama. Pengawas ujian tepat waktu dalam memulai ujian. Karena ada panitia ujian, maka tidak boleh ada UAS yang ditunda.

Edisi ke-27 Tahun 2008

41

045 Aripriharta; Wibawanto, Slamet. 2007. Implementasi Administrasi Virtual Berbasis Internet pada Sistem Informasi Akademik (SIAKAD) sebagai Wujud Pelayanan Primadi Lingkup Internal Jurusan Teknik Elektro

Kata-kata kunci: SIM, SIAKAD, administrasi, web-database, intranet

Sistem Informasi Manajemen (SIM) yang dalam hal ini diwujudkan sebagai administrasi virtual sistem informasi akademik (SIAKAD virtual) berbasis teknologi web-database dan jaringan komputer lokal (intranet). SIAKAD virtual merupakan salah satu alat atau sarana yang berguna untuk memperbaiki kinerja layanan Institusi Jurusan Teknik Elektro ­FTUM. Kinerja layanan sangat berpengaruh terhadap kepuasan pelanggan. Kinerja layanan yang berkualitas prima (layanan prima) akan tercapai apabila ada indikasi kepuasan dari pelanggannya, termasuk dalam manajemen informasi akademik, kualitas layanan menjadi sasaran yang dibidik oleh jurusan TEFTUM. Pada kasus pengguna informasi dalam area lokal suatu instansi (Aripriharta, 2006:1), sebagai contoh Jurusan Teknik Elektro FTUM dapat dibagun database sistem informasi virtual mengunakan jaringan komputer area lokal (LAN). Instalasi software basis data pada sistem LAN dipilih dengan pertimbangan bahwa pengguna (user) terdiri atas para dosen, laboran dan mahasiswa di lingkungan Jurusan Teknik Elektro FTUM. Sebagai contoh, seorang dosen dapat mengakses informasi dengan cepat mengenai data KP4 kemudian mengupde CV dan jadwal kuliahnya. SIAKAD didesain dengan menggunakan web aplication software yakni php-mySQL yang diakses melalui tools pada wamp server. Hasil implementasi menunjukkan bahwa SIAKAD telah bekerja dengan baik ukuran ini diperoleh dari hasil ujicoba. Dalam gambar tersebut terlihat beberapa dosen telah memiliki username dan password untuk halk akses SIAKAD. Dosen-dosen yang telah terlihat fotonya telah berhasil mengupload data CV, surat tugas, jadwal mengajar dan fitur lainnya. Ini berarti SIAKAD telah berhasil di implementasikan dengan baik dan dapat menunjang tercapainya pelayanan prima di Jurusan TE-FTUM. 046 Sumarsono, R. Bambang; H. Sultoni; Kusumaningrim, Desi Eri. 2007. Pengetahuan, Sikap, dan Minat Berwirausaha bagi Mahasiswa Jurusan Administrasi Pendidikan FIP UM

Kata-kata kunci: persepsi, sikap, minat, berwirausaha

42

Abstrak Hasil Penelitian

Penelitian ini menggunakan rancangan penelitian deskriptif korelasional, dengan teknik pengumpulan data yaitu menggunakan angket. Analisis data menggunakan persentase dan korelasi product moment. Hasil penelitian menunjukkan bahwa: (1) sebanyak 39 atau 48,8% responden memiliki kecenderungan persepsi yang baik terhadap wirausaha; (2) sebanyak 45 atau 56,3% responden, memiliki kecenderungan sikap yang baik terhadap wirausaha; (3) sebanyak 39 atau 48,8% responden, memiliki kecenderungan minat yang sangat tinggi terhadap wirausaha; dan (4) adanya pengaruh yang signifikan antara persepsi dan sikap mahasiswa terhadap minat berwirausaha, hal ini ditunjukan dengan sumbangan efektif variable X1 terhadap variable Y sebesar 25% dan variable X2 terhadap variable Y sebesar 43%. 047 Purnami, Sri; Sudjana, I Nengah. 2007. Profil Guru Pendidikan Jasmani Sekolah Dasar di Kabupaten Malang

Kata-kata kunci: profil guru, pendidikan jasmani, sekolah dasar

Penelitian ini berupaya mengkaji profil guru pendidikan jasmani dalam membelajarkan siswanya, ditinjau dari kompetensinya dalam hal perencanaan pembelajaran, pelaksanaan pembelajaran, dan dalam penilaian pembelajaran. Masalah itu mendesak dipecahkan mengingat data dan informasi tentang profil guru penjas dalam membelajarkan siswanya relatif sedikit, bahkan boleh dikatakan sangat minim. Subyek penelitian ini adalah 73 guru penjas SD pada 21 Kecamatan yang ada di wilayah Kabupaten Malang. Pengumpulan data dilakukan dengan menggunakan instrumen angket, yang terdiri dari 35 item pernyataan. Hasil penelitian menunjukkan guru-guru pendidikan jasmani SD setuju dan sangat setuju terhadap aspek-aspek yang diharapkan dilakukan oleh guru penjas dalam fase perencanaan, yaitu penyusunan RPP hendaknya mencerminkan suasana penjas, sesuai dengan karakteristik siswa, sesuai dengan perkembangan siswa, disusun secara sistematis, sesuai dengan kemampuan siswa, meningkatkan peran aktif siswa, mengoptimalkan belajar siswa, digunakan satu kali pertemuan, sesuai dengan peralatan yang ada, dan sesuai dengan sikon lingkungan Profil ideal dalam pelaksanaan pembelajaran yang diharapkan dilakukan oleh guru penjas yaitu: hendaknya disampaiakan secara jelas, sesuai dengan RPP, diberikan secara variatif, mengacu pada tujuan, berurutan sesuai perkembangan, peragaan oleh guru jelas, metode sesuai dengan sikon, strategi sesuai dengan kebutuhan, membangkitkan parti-

Edisi ke-27 Tahun 2008

43

sipasi siswa, memungkinkan siswa bereksplorasi, strategi sesuai dengan lingkungan, memberi penguatan positif, membangkitkan motivasi siswa, memberi koreksi, memberi umpan balik, terbuka terhadap respon siswa, bergairah dalam mengajar, informasi mudah dipahami, menciptakan kebersamaan dan pembelajaran penjas dilakukan dengan mengoptimalkan waktu yang disediakan. Profil penilaian pembelajaran penjas yang diharapkan dilakukan guru adalah evaluasi dilakukan setelah satu kompetensi dasar tealah dicapai, evaluasi dilakukan sesuai dengan tingkat perkembangan siswa, evaluasi mengacu pada tujuan pembelajaran, aspek yang dinilai sesuai dengan aktivitas pembelajaran, dan teknik evaluasi sesuai dengan materi ajar. Temuan penelitian ini mendukung pijakan teoritis yang melandasi kajian profil guru, sehingga saran yang diusulkan adalah perlunya sosialisasi atas proses dari hasil penelitian ini, dan perlu juga dilakukan penelitian lanjutan pada kancah yang lebih luas dan dengan jabaran konstrak yang lebih operasional. 048 Sumanto; Supraptiningsih, Umi. 2007. Kajian Estetika Bentuk-bentuk Undangan Perkawinan dalam kehidupan Masyarakat di Jawa Timur

Kata-kata kunci: kajian estetika, kartu undangan perkawinan, masyarakat Jatim

Penelitian ini betujuan untuk mendiskripsikan konsep estetika pada bentuk-bentuk undangan perkawinan yang ada dalam kehidupan masyarakat di Jawa Timur. Tujuan khususnya untuk mendeskrip-sikan: (1) keragaman bentuk undangan perkawinan; (2) visualisasi bentuk-bentuk kartu undangan perkawinan; dan (3) nilai estetika pada bentuk-bentuk kartu undangan perkawinan yang ada dalam kehidupan masyarakat di Jawa Timur. Hasil penelitian menunjukkan bahwa konsep estetika pada kartu undangan perkawinan tercermin dari kesan kompoisisi teks dengan aspek gambar, ornamen, atau foto yang ditampilkan, karakter warna kertas dan tulisan, tipografi, makna religius serta keindahan pernak-pernik lainnya. Kualitas estetika dari kartu undangan perkawinan ditentukan oleh model kreasi undangan yang dibuat sesuai selera ekspresi pribadi kedua calon pengantin dan orang tuanya.

44

Abstrak Hasil Penelitian

049 Nawawi, Imam; Adi, Eko Pramono; Susilo, Singgih. 2007. Perilaku Hidup Sehat dan Bersih Pada Keluarga Miskin di Kabupaten Malang (Studi di Desa Jambearjo, Kecamatan Tajinan)

Kata-kata kunci: kajian estetika, kartu undangan perkawinan, masyarakat Jatim

Penelitian tentang perilaku hidup bersih dan sehat pada masyarakat miskin di desa Jambearjo ini mempunyai empat tujuan. Pertama, untuk mengetahui perilaku hidup bersih dan sehat masyarakat miskin secara umurn ; kedua mengetahui perilaku hidup bersih dan sehat masyarakat miskin ditinjau dari segi ekonomi; ketiga mengetahui perilaku hidup bersih dan sehat pada masyarakat miskin; ke empat, untuk mengetahui perilaku hidup bersih dan sehat masyarakat miskin terkait dengan tingkat mordibitasnya. Penelitian ini dilakukan. di Desa Jambearjo-Tajinan, Kab. Malang. Teknik pengambilan data rnenggunakan teknik purposive. Populasi dalam penelitian ini adalah semua keluarga miskin di Desa Jambearjo, dengan sampel sebanyak 60 keluarga. Data yang digunakan adalah data primer dan sekunder. Data primer diperoleh dengan menggunakan daftar pertanyaan dan data sekunder diperoleh dari lembaga atau instansi terkait. Analisis data menggunakan tabulasi tunggal dan tabulasi silang dua variabel. Hasil penelitian menunjukkan bahwa; (1) Masyarakat miskin Desa Jambearjo sudah berperilaku hidup bersih dan sehat; (2) Sebagian besar (80%) responden berpenghasilan rendah (kurang dari Rp. 75.OOO/minggu) hal ini berpengaruh pada kemampuan memenuhi sarana hidup bersih dan sehat. Misalnya beberapa diantara mereka belum mampu membangun jamban keluarga; (3) Tingkat pendidikan responden yang tergolong rendah berpengaruh terhadap pengetahuan hidup bersih dan sehat; (4) Tingkat mordibitas masyarakat relatif rendah, karena sebagian besar (74%) responden tidak pernah sakit, hanya sebagian kecil (26%) pernah mengalamii sakit diare, dan gatal-gatal. 050 Awaliyah, Siti. 2007. Pelaksanaan Pendidikan Moral dalam Pengembangan Kepribadian Santri di Pondok Pesantren An-Nur II Kabupaten Malang

Kata-kata kunci: pendidikan moral, pondok pesantren

Pondok pesantren adalalah salah satu lembaga pendidikan non formal yang mempelajari tentang ilmu agama Islam. Kegiatan-kegiatan yang

Edisi ke-27 Tahun 2008

45

dilaksanakan bermuatan moral karena semuanya berlandaskan pada agama. Dalam salah satu Hadits Nabi disebutkan bahwa agama adalah akhlak atau moral. Jadi, pondok pesantren merupakan salah satu lembaga yang berkompeten untuk membentuk moral yang baik. Penelitian ini bertujuan untuk mengetahui pelaksanaan pendidikan moral di Pondok Pesantren An-Nur II Kabupaten Malang, yang mencakup dasar hukum pelaksanaan pendidikan moral, kegiatan-kegiatan yang berkaitan dengan pelaksanaan pendidikan moral, dan kendala-kendala yang dihadapi dalam pelaksanaan pendidikan moral. Untuk mencapai tujuan tersebut, peneliti memperoleli data dan Kyai, selaku pengasuh pondok pesantren, ustadz, santri dan masyarakat sekitar. Pendekatan yang digunakan dalam penelitian mi adalah pendekatan yang bersifat kualitatif. Teknik penguinpulan/perekaman data yang digunakan adalali observasi, wawancara dan dokumentasi.Untuk menganalisis data menggunakan analisis interaktif, meliputi reduksi data, panyajian data dan menarik kesimpulan atau verifikasi. Dari hasil penelitian yang dilakukan diperoleh hasil sebagai berikut. Pertama, landasan hukum yang digunakan dalam pelaksanaan pendidikan moral di Pondok Pesantren An-Nur II adalah Pancasila, UUD 1945, AlQur`an, Hadits dan ijtihad para ulama (ijma dan qiyas). Kedua, kegiatan yang berkaitan dengan pelaksanaan pendidikan moral diantaranya sholat, pembelajaran (kitab kuning), kegiatan spiritual (Istigotsah, pengajian ahad Legi dan Waqi`ah). Ketiga, kendala-kendala yang dihadapi adalah faktor santri, model pembelajaran, pendanaan, ustadz, masyarakat sekitar. Berdasarkan hasil penelitian lapat disimpulkan bahwa pesantren ml termasuk pesantren tua yang cukup sukses. Kriterianya darn jumlah santri, luas tanah dan bangunan serta kepercayaan masyarakat yang cukup tinggi. Kondisi demikian menjadikan pesantren ini sebagai tempat yang tepat untuk pembentukan moral yang baik bagi santri. Untuk lebih meningkatkan hasil yang akan dicapai perlu dikembangkan suatu model pembelajaran yang sesuai dan lebih mengembangkan konsep pemikiran santri. 051 Astuti, Yuni; Prantiasih, Arbaiyah. 2007. Studi Kasus terhadap Kasus Kekerasan Anak dalam Rumah Tangga di Kota Malang Raya

Kata-kata kunci: KDRT, kota Malang

Penelitian ini didasarkan pada realita bahwa fenomena kekerasan anak dalam rumah tangga masih terus terjadi dalam rumah tangga; anak yang masa kecilnya ternoda oleh kekerasan yang dilakukan oleh orang tua,

46

Abstrak Hasil Penelitian

kerabat dan masyarakat. Ironisnya bahwa pelaku kekerasan fisik maupun seksual adalah orang terdekat korban, yaitu orang tua kandung; orang tua tin, kerabat dan tetangga. Bentuk kekerasan terhadap anak yang terjadi dalam rumah tangga meliputi kekerasan fisik, kekerasan emosional atau psikologis, kekerasan seksual, kekerasan ekonomi dan kekerasan sosial. Kekerasan terahadap anak dalam rumah tangga karena faktor ekonomi. Faktor penyebab dan pendorong keterlibatan anak dalam aktivitas ekonomi sehingga anak kehilangan waktu untuk bermain dengan usia sebayanya sehingga anak kehilangan dunia anak-anak untuk berkembang karena anak harus membantu orang tuanya dan sekaligus menghidupi dirinya sendiri sehingga anak tereksploitasi keluarga. Dampak kekerasan sosial pada anak maka anak menjadi kuper, anak kurang berkembang karena geraknya dibatasi, diikat kebebasannya. Disamping faktor penyebab terjadinya kekerasan anak dalam rumah tangga lebih banyak disebabkan oleh faktor-faktor yang sifatnya permasalahan hidup dan kondisi sosial rumah tangga (keluarga) dan secara umum karena tekanan kemiskinan dalam keluarga. 052 Al Atok, A. Rosyid; Untari, Sri; Al Hakim, Suparlan. 2007. Ragam Proses Pengambilan Keputusan Moral Kelompok Mahasiswa dalam Lingkup Moralitas Sosiokultural

Kata-kata kunci: proses pengambilan keputusan moral, moralitas, sosiokultural

Pengambilan keputusan moral biasanya menggunakan referensi pola tindakan moral tertentu antara lain berupa karakter moral. Secara teoritis karakter moral (moral disposition) adalah sikap moral atau kebiasaan berpikir dan bertindak yang kondusif bagi berfungsinya dan kelangsungan sistem sosial. Masalah perbedaan keputusan moral di atas perlu diteliti ragamnya, sehingga diperoleh gambaran proses pengambilan keputusan moral oleh mahasiswa, khususnya mahasiswa Jurusan PPKn Fakultas Ilmu Pendidikan Universitas Negeri Malang. Jurusan ini memiliki tugas utama membina dan mengembangkan matakuliah yang berkaitan dengan moral Pancasila, moral hukum, moral kenegaraan dan matakuliah lainnya yang sangat memerlukan informasi mengenai cara pengambilan keputusan moral yang dilakukan mahasiswa berdasarkan pengalaman belajarnya. Permasalahan dalam penelitian ini dapat dirumuskan sebagai berikut: (1) Bagaimana ragam moralitas sosiokultural yang berkembang dalam kehidupan mahasiswa; (2) Bagaimana ragam problematik moral yang dihadapi oleh mahasiswa dalam kehidupannya; dan (3) Bagaimana ragam

Edisi ke-27 Tahun 2008

47

proses pengambilan keputusan moral mahasiswa dengan menggunakan referensi moralitas sosiokultural? Penelitian ini dirancang untuk mendeskripsikan tentang proses pengambilan keputusan moral di lingkungan mahasiswa. Dengan demikian penelitian ini dirancang sebagai penelitian deskripstif. Pola proses tersebut dapat diperoleh melalui observasi kelompok dan wawancara dalam diskusi. Penelitian ini akan dilakukan di Jurusan PPKn Fakultas Ilmu Pendidikan Universitas Negeri Malang dengan subyek penelitian adalah mahasiswa yang terdaftar sebesar 218 mahasiswa. Data yang terkumpul dari observasi dan angket/kuesioner ini dianalisis dengan dua cara, yakni teknik analisis persentase untuk mengukur sikap moral yang menunjukkan kemampuan subyek penelitian dalam pengambilan keputusan moral yang dilematis dalam diskusi kelompok dan teknik analisis dengan Model analisis interaksi atau Interactive Model of Analysis (Milles & Huberman. 1992) yang ditempuh dengan langkah-langkah: (1) reduksi dan deskripsi data (data reduction) mengenai pengalaman responden tentang nilai-nilai moral yang diperoleh dari keluarga, masyarakat, agama yang dianut dan pengalaman kuliah, selanjutnya reduksi data tentang proses keputusan moral mengenai masalah moral kemasyarakatan yang dilematis; (2) sajian data ( data display) dengan menetapkan hubungan antara nilai-nilai moral yang dimiliki dengan ragam proses pengambilan keputusan moral yang ditetapkan sebagai landasan untuk bertindak; dan (3) penarikan kesimpulan/verifikasi (conclusion: drawing/verifying) mengenai ragam pola keputusan moral berdasarkan hubungan antara pengetahuan nilai-nilai moral dengan proses pengambilan keputusan moral. Hasil Penelitian dapat disimpulkan bahwa (1) Ragam moralitas sosiokultural yang berkembang dalam kehidupan pemahaman mahasiswa mengenai jenis ajaran moral dasar dan khusus yang diyakini telah digunakan sebagai acuan dalam menghadapi masalah moral yang dilematis; (2) Jenis ajaran moral yang cenderung digunakan oleh mahasiswa dalam menghadapi masalah moral adalah modal dasar (norma moral, agama, sosial, dan hukum), dan moral khusus (norma individu, keluarga dan adat). Penampilan sikap moral mahasisa masalah dilematis didasarkan atas konsep harga diri, minat terhadap rasa kemanusiaan dan mengacu pada moral; dan (3) Penalaran moral yang beraspek perasaan, kecenderungan memilih ke arah yang positif, negatif atau netral, dan pencapaian hasil tindakan yang dapat dipertanggung jawabkan. Hasil penelitian ini menunjukkan mahasiswa dapat menggunakan penalaran moral sebagai pertimbangan dan pengambilan keputusan dalam menghadapi kenyataan dilematis, sehingga sangat efektif bagi pengembang-

48

Abstrak Hasil Penelitian

an kelompok mata kuliah yang beraspek moral. Pengembangan ini diperlukan untuk membiasakan mahasiswa mengambilan keputusan yang bertanggungjawab. 053 Kinanti, Rias Gesang; Merawati, Desiana; Devi, Mazarina. 2007. Perspektif Gizi dalam Meningkatkan Harapan Hidup Lansia di Kota Malang

Kata-kata kunci: lansia, status gizi, pola makan, harapan hidup pengetahu-an gizi, kebiasaan makan

Peningkatan masalah gizi ganda merupakan ancaman bagi peningkatan angka harapan hidup masyarakat, sehingga masih menjadi masalah mendasar dalam meningkatkan harapan hidup tersebut. Sebab gizi ganda merupakan salah satu faktor pencetus peningkatan frevalensi penyakit degeratif khususnya bagi lansia. Dua per tiga penyakit pada lansia (lanjut usia) berkaitan dengan masalah gizi. Salah satu penyebab masalah tersebut adalah kurangnya pemahaman dan pengetahuan tentang gizi, yang dapat berpengaruh terhadap prilaku makan, pola makan dan kebiasaan makan. Masalah mendasar dalam usaha meningkatkan kesehatan dan kualitas hidup lansia dalam meningkatkan harapan hidup, berkaitan dengan keseimbangan dan kecukupan gizi. Atas dasar tersebut maka penelitian ini ingin mengungkap, perilaku makan para lansia, konsumsi gizi berkaitan kecukupan gizi dan menganalisis faktor pencetus perubahan prilaku makan dan kecukupan gizi pada lansia, dengan menggunakan disain penelitian ini adalah crosssectional dengan menggunakan metode survei. Populasi penelitian adalah lansia anggota aktif posyandu lansia yang berumur 60 tahun keatas, pemilihan sampel dilakukan dengan menggunakan kriteria sebagai berikut: tidak pikun, tidak mengalami gangguan pendengaran, tidak lumpuh dan bersedia diwawancarai. Variabel terukur dalam penelitian ini adalah Perilaku makan, tingkat konsumsi gizi, pengetahuan gizi, status sosial ekonomi. Pengumpulan data dilakukan dengan wawancara dan pengisian angket, kemudian dilakukan analisis terhadap pertanyaan, dengan menggunakan uji statistik deskriptif. Berdasarkan hasil penelitian menunjukan bahwa prilaku makan, sikap dan pilihan makan dipengaruhi oleh pengetahuan gizi. Namun selama ini prilaku makan pada lansia lebih banyak dipengaruhi oleh faktor kebiasaan yang turun-temurun. Oleh sebab itu dapat disimpulkan bahwa kebiasaan makan yang tidak dilandasi oleh pengetahuan gizi yang memadai dapat menyebabkan peningkatan frevalensi gizi masyarakat. Hasil penelitian ini

Edisi ke-27 Tahun 2008

49

akan memberikan informasi Penelitian ini dapat dijadikan dasar informasi bagi berbagai pihak baik pihak pemerintah khususnya bagi Departemen kesehatan atau yang terkait atau bagi pihak swasta sebagai bahan masukan untuk perencanaan dan pengembangan program pelayanan kesehatan khusus para lansia, diharapkan menjadi masukkan bagi keluarga lansia untuk berperilaku hidup sehat dengan melakukan perbaikan perilaku makan dan perawatan bagi lansia. Sebagai upaya memberikan motivasi bagi lansia untuk meningkatkan kemandirian dan kesehatan 054 Sriwardhani, Tjitjik; Herawati, Ida Siti. 2007. Desain Busana dan Tata Rias pada Perkawinan Adat Tradisional `Malangan'; Kajian Estetik dan Makna Simboliknya

Kata-kata kunci: busana dan tata rias, perkawinan adat Malangan`

Penelitian ini bertujuan untuk mendeskripsikan kajian estetik dan makna simbolik desain busana dan tata rias perkawinan adat tradisional Malangan`, serta mendeskripsikan faktor pendukung dan penghambat perkembangannya yang merupakan refleksi makna sistem nilai masyarakat Malang, Jawa Timur. Jenis penelitian ini adalah penelitian deskriptif dengan menggunakanl pendekatan kualitatif. Metode yang digunakan adalah observasi partisipatoris, wawancara dan dokumentasi. Prosedur anatisa menggunakan teknik induksi, dengan pendekatan form content analysis serta pengecekan keabsahan data menggunakan triangulasi untuk mendapatkan data yang dapat dipercaya dan dipertanggung jawabkan. Hasil analisis data mengungkapkan bahwa: (1) desain busana pengantin menggunakan busana basahan`, dengan kain panjang nyampung tumpal` menghadap ke kanan berwarna dasar hijau dan kuning emas. Memakai dodot motif Taman Sari` dibentuk menjadi Tirto Sumilak` sedang pengantin putra mengenakan celana panjang warna kuning emas, dengan kain motif dan warna Nyamping Tumpal Malangan,dibentuk menjadi Projo Gumetar` dengan motif bunga padma` dan motif stupa`. Digali dari masa kejayaan kerajaan Singosari pada hiasan relief atau arca candi, serta permaisuri Ken Dedes yang sangat cantik. Motif keduanya merupakan perpaduan warna hijau atau coklat dipadu dengan kuning keemasan, putih dan merah yang sangat harmonis dengan kesan keanggunan. Warna merah atau bang` selalu digunakan sebagai ciri khas, yang mempunyai makna keberanian perjuangan sang raja pada saat melawan penjajah dengan berceceran darah. Sedang Malang Keputren menggunakan busana panjang

50

Abstrak Hasil Penelitian

bludru,kain gerinsing bang` motif bunga padma warna emas, diiengkapi sabuk pending pitaloka` dan selendang nawangan` kuning emas sebagai lambang kejayaan Singosari (2) konsep tata rias tidak berbeda dengan penampilan Ken Dedes yang sangat cantik, tata rias pengantin Malang Keprabon sesuai dengan konteks riasan pengantin basahan` menggunakan warna coklat, orange dan kuning, yang dimaknai dengan kemegahan dan kewibawaan. Riasan rambut dengan rajutan melati Purnomo Sidi` melingkari tepi sanggul, dan penetep Puspo Padma`, serta kembang goyang 9 dan 5 untuk Matang Keputren. Mengenakan Jamang dan kuluk Makhuto Keprabon` serta udeng dengan bros suryo gumelar` digunakan pengantin putra, (3) adanya perkumpulan perias pengantin Harpi Melati` merupakan sarana organisasi yang berusaha memasyarakatkan gaya pengantin adat tradisioanal Matangan` ke berbagai sasaran yang lebih luas. Namun kurangnya sosialisasi menyebabkan perkembangannya kurang tercapai secara maksimal Berdasarkan hasil kajian dapat disarankan untuk melakukan penelitian lanjutan, dan mensosialisasikannya pada kalangan yang lebih luas, serta diusulkan dimasukkan dalam kurikulum sebagai muatan lokal yang diterapkan di sekolah-sekolah Berdasarkan kajian terhadap nilai eatetik dan makna simbolik pada desain busana dan tata rias pengantin adat tradisional Malangan` khususnya pada desain batik gerinsing bang` yang bermotif bunga padma` sangat dimungkinkan apabila motif tersebut dilakukan sebagai motif batik Malangan, yang sarat dengan nitai estetik dan makna simboliknya. 055 Suherjanto, Indra; Kamal, Mustofa. 2007. Ekspresi Tutur Basa-Basi dalam Masyarakat Remaja Kota Malang

Kata-kata kunci: tindak tutur, basa-basi, remaja kota Malang

Wujud tindak tutur basa-basi masyarakat remaja kota Malang berupa kalimat imperatif, interogatif, atau pun deklaratif Tindak tutur basa-basi yang diekspresikan oleh masyarakat remaja kota Malang menggambarkan dan merefleksikan norma-norma dan nilai sosial budaya masyarakat remaja kota Malang. Situasi tuturan di kalangan remaja kota Malang meliputi situasi sekolah dan luar sekolah. Situasi sekolah yang dimaksud adalah waktuwaktu luang disaat menjelang masuk kelas, saat-saat istirahat, dan saat pulang sekolah. Topik yang lebih banyak dipergunakan remaja kota Malang dalam tuturan basa-basi adalah topik yang berkaitan dengan kegiatan

Edisi ke-27 Tahun 2008

51

menjelang masuk kelas, saat istirahat, dan saat pulang sekolah, seperti :topik tugas di sekolah/ PR, topik kegiatan pertemuan pelajar seni di Diknas, dan topik peristiwa yang dialami ketika berangkat sekolah Situasi di luar sekolah adalah waktu-waktu diluar jam sekolah, waktu libur, dan waktu kegiatan-kegiatan ekstra kulikuler. Topik yang lebih banyak digunakan adalah topik yang berkaitan dengan kegiatan setelah atau kegiatan ekstra kurikuler, seperti topik kesepakatan untuk bertemu, topik tentang taman bunga kelas,topik pengisi acara atau tari (dance) Disamping itu ada beberapa topik lain yang dipergunakan remaja kota Malang sebagai tuturan basa-basi seperti topik sikap atau pribadi, topik hubungan sosial atau keluarga, topik hubungan pribadi antar individu Tindak tutur basa-basi remaja kota Malang bergantung pada faktor bahasa yang digunakan penutur untuk menyampaikan maksud, faktor siapa mitra tutur yang akan menjadi penerima tuturan, faktor konteks tuturan, dan faktor struktur bahasa yang akan digunakan. Bahasa tutur yang digunakan remaja kota Malang adalah bahasa nonformal baik bahasa Indonesia, maupun bahasa Jawa. Mitra tuturnya adalah sesama remaja dikalangan mereka, orang yang lebih dewasa/ orang tua dengan konteks kesopanan yang berbeda. Jika mitra tuturnya lebih tua atau dewasa cenderung menggunakan bahasa Indonesia atau bahasa Jawa yang dikromokan atau halus. Fungsi tindak tutur basa-basi remaja kota Malang meliputi fungsi kompetitif, kolaboratif, dan konflik dengan kalimat imperatif, interogatif, atau pun deklaratif. Wujud tuturan basa-basi remaja kota Malang dibedakan menjadi tindak tutur langsung dan tindak tutur tidak langsung. Tindak tutur langsung perwujudannya disampaikan dalam tuturan lugas, yakni kalimat tanya yang difungsikan untuk melakukan tindak bertanya, kalimat perintah yang difungsikan untuk melakukan tindak memerintah, meminta, atau pun mengajak, dan kalimat berita difungsikan untuk mengatakan atau memberitakan sesuatu. 056 Karkono; Kamal, Mustofa. 2007. Nilai Filosofis Tembang-tembang Macapat dalam Naskah Lengendriyan (Dramatari Berdialog Tembang) Lakon Ronggolawe Gugur

Kata-kata kunci: seni tembang macapat, naskah legendriyan

Kesenian langendriyan dapat dikatakan berbeda dengan keseniankesenian lain yang ada, khususnya di daerah Surakarta Jawa Tengah.

52

Abstrak Hasil Penelitian

Langendriyan adalah paduan dua seni sekaligus, yaitu seni tari dan seni suara (tembang). Dalam mementaskan Langendriyan, para pemain tidak hanya dituntut memiliki kemampuan menari saja, tetapi juga harus mampu menembangkan tambang-tembang yang ada di dalam naskah sesuai peran masing-masing. Menterjemahkan cerita ke dalam bentuk tembang macapat tentu bukan hal yang mudah, karena tembang macapat sendiri memiliki aturanaturan baku yang harus ditaati, seperti: guru gatra, guru lagu, dan guru wilangan. Kata-kata yang digunakan dalam rangkaian tembang-tembang macapat tersebut ternyata memiliki makna-makna filosofis yang tidak bisa begitu saja dicerna oleh orang awam yang kurang bisa memahami sistem bahasa dan budaya Jawa yang ada. Penelitian ini adalah sebuah penelitian deskriptif kualitatif terhadap drama tari berdialog tembang (Langendriyan) lakon/episode Ranggalawe Gugur versi Sekolah Menengah Karawitan Indonesia (SMKI) Negeri Surakarta. Penelitian ini dilakukan dengan pendekatan struktural untuk menganalisis unsur-unsur intrinsiknya yang kemudian dirangkai dengan mnganalisis nilai-nilai filosofis yang ada di dalam keseluruhan naskah. Sumber data primer penelitian ini adalah naskah Langendriyan lakon Ranggalawe Gugur yang pernah dipentaskan oleh siswa-siswa program studi seni tari SMKI Negeri Surakarta. Adapun objek yang diteliti adalah konsep-konsep atau unsur-unsur struktural yang tertuang dalam bentuk tembang-tembang macapat. Hasil penelitian ini adalah dideskripsikannya nilai-nilai filosofis yang terkandung dalam keseluruhan tembang yang digunakan dalam naskah Ranggalawe Gugur, beserta paparan unsur-unsur intrinsiknya. Penelitian ini masih sangat terbuka dan memungkinkan untuk diadakan penelitian lanjutan karena masih banyak hal-hal yang perlu dikupas, dikaji, dan kemudian disebarluaskan kepada masyarakat luas. Maka, penelitian ini dapat pula dijadikan sebagai bahan ataupun sumber data bagi penelitian selanjutnya. 057 Widiati, Nita; Karkono. 2007. Eksistensi Nilai Cinta Kasih untuk Pembelajaran Apresiasi Sastra (Kajian terhadap Novel Ayat-Ayat Cinta Karya Habiburrahman El Shirazy)

Kata-kata kunci: novel, sastra, ayat-ayat cinta

Penelitian ini bertujuan untuk menentukan, mendeskripsikan dan menginterpretasikan nilai cinta kasih yang mencakup pola pikir, tingkah laku, dan sikap tokoh di dalam novel Ayat Ayat Cinta. Pelacakan nilai cinta kasih

Edisi ke-27 Tahun 2008

53

tokoh dalam novel ini dengan cara mengamati kecenderungan tokoh dalam berperilaku. Penelitian ini menggunakan rancangan deskriptif dengan analisis kualitatif. Sumber data penelitian mi adalah novel Ayat Ayat Cinta yang terdiri dan 33 bagian episode penceritaan, yaitu (1) Gadis Mesir itu Bernama Maria, (2) SyaikhMuda, (3) Kejadian di Dalam Metro, (4) Mein Name 1st Aisha, (5) Ashir Ashab dan Maria, (6) Keributan Tengah Malam, (7) Air Mata Noura, (8) Pertemuan di Tahrir, (9) Hadiab Perekat Jiwa, (10) Di Cleopatra Restaurant, (11) Getaran Cinta, (12) Merancang Peta Hidup, (13) Sepucuk Surat Cinta, (14) Dijenguk Sahabat Nabi, (15) Siapa Malaikat itu?, (16) Ketika Hati Berdesir-desir, (17) Badai Kegelisahan, (18) Pertemuan, (19) Cobaan, (20) Ikatan Suci, (21) Kecupan Pertama, (22) Saat saat Indah di Tepi Sungai Nil, (23) Rencana-rencana, (24) Surat dan Nurul, (25) Di San Stefano, Alexandria, (26) Penangkapan, (27) Dalam Penjara Bawah Tanab, (28)Tangis Aisha, (29) Persidangan, (30) Ayat Ayat Cinta, (31) Diary Maria, (32) Sidang Penentuan, dan (33) Nyanyian dan Surga, dan keseluruhan isi novel ini terdiri dari 389 halaman. Pendekatan yang digunakan dalam penelitian mi adalab kajian objektif terhadap tokoh dengan nilai cinta kasih yang dianutnya. Sebagai novel budaya, Ayat Ayat Cinta syarat dengan nilai multikultur. Bertemunya komunitas beragam budaya diungkapkan dengan pola pikir yang berbeda, tingkah laka yang berbeda, sikap yang berbeda, namun berhasil disikapi dengan pola pikir, tingkah laku, dan sikap yang mengacu pada satu tujuan, yaitu cinta Ilahiah, kebenaran cinta atas kebenaran agama (Islam). Berdasarkan pemahaman nilai-nilai itulah, melalui novelnya El Shirazy mengangkat cinta kasih sebagai suatu hal yang mengikatkan seseorang tidak hanya dengan seseorang lainnya, tetapi juga mengikatkan keduanya dengan hukum dan keberadaan Tuhan Pencipta Maha Seluruh. Dalam teori nilai Spranger dijelaskan adanya enam orientasi nilai yang disebut sebagai the type of man atau tipe manusia, yaitu nilai teoretik, nilai ekonomis, nilai estetik, nilai sosial, nilai politik, dan nilai agama. Keenam tipe tersebut berada dan dimiliki oleh tokoh-tokoh dalam novel Ayat Ayat Cinta, karena keberadaan nilai cinta kasih disipati oleh apa yang disebut Spranger sebagai tipe manusia tersebut. Pengertiannya sesuatu dipandang akan memiliki nilai apabila dipersepsi sebagai sesuatu yang diinginkan dalam pola pikir, dan keinginan untuk memperolehnya mempengaruhi sikap dan tingkah Iaku seseorang. Sebagai penulis muda El Shirazy telah mampu mengekspresikan nilai cinta kasih dengan pencitraan moral, kearifan, eksistensi tokoh-tokoh sesuai dengan latar budaya yang menghidupinya.

54

Abstrak Hasil Penelitian

058 Syafaat; Hanafi, Yusuf. 2007. Stilistika Kalimat Al-Quran (Juz 1 Sampai Juz 15) dan Efek Makna yang Ditimbulkan

Kata-kata kunci: stilistika, aspek sintaksis, efek makna

Al-Quran diturunkan dengan menggunakan kosakata dan tatabahasa yang populer dan lazim digunakan oleh masyarakat Arab saat itu, bahkan alQuran sarat dengan makna serta gaya bahasa yang indah. Seorang cendekiawan Inggris Marmaduke Pickthall dalam The Meaning of Glorious Quran menyatakan bahwa al-Quran mempunyai simfoni yang tiada taranya di mana setiap nadanya bisa menggerakkan manusia untuk menangis dan bersuka cita. Namun ada sebuah pertanyaan besar yang sedang menyeruak ke permukaan, baik dari kalangan pengajar, pembelajar bahasa Arab maupun masyarakat umum. Yakni, mengapa beberapa kalimat al-Quran cenderung lebih sulit untuk dipahami dibanding teks bahasa Arab lainnya sehingga diperlukan media buku tafsir atau terjemahan. Apa sesungguhnya yang membedakan teks al-Quran dengan teks lain yang sama-sama berbahasa Arab Berangkat dari masalah di atas, peneliti berasumsi bahwa mungkin kesulitan ini muncul karena bentuk sintaksis al-Quran mempunyai keunikan, kekhasan tersendiri. Sementara ini, kajian sintaksis Arab (nahwu dan syaraf) hanya membahas kaidah-kaidah umum saja dan kalaupun dibahas, sintaksis al-Quran itu hanya diberikan porsi yang kecil, yakni sebagai mustatsnayat (eksepsi dari kaidah umum). Oleh karena itu, peneliti tertarik untuk membuktikan kebenaran hipotesis di atas sekaligus mengkaji lebih dalam tentang seluk-beluk stilistika sintaksis al-Quran. Penelitian ini dilakukan untuk menganalisis bentuk-bentuk stilistika sintaksis dalam al-Quran dan efek maknanya. Kajian ini sangat luas cakupannya, oleh sebab itu peneliti membatasi lingkup penelitian hanya pada juz 1 s.d 15 yang berjumlah sekitar 3333 ayat. Stilistika sintaksis al-Quran di sini hanya difokuskan pada struktur sintaksis al-Quran yang mengandung kekhasan tersendiri bila dikomparasikan dengan kaidah dan struktur umum sintaksis bahasa Arab, dan juga memfokuskan pada struktur kalimat yang tidak sama redaksinya. Setelah dilakukan identifikasi data stilistika dalam kalimat-kalimat alQuran juz 1--15 dari aspek sintaksis, maka ditemukan tujuh bentuk stilistika sintaksis, yaitu: (a) penghilangan huruf dan kata (idlmar al-harf wa alkalimah); yang tersebar di 89 tempat dan meliputi penghilangan mubtada', khabar, fi'il, ya mutakallim dan ya' manqush serta mudlaf ilaih dan makhsus dzamm; (b) Penambahan huruf dan kata (idhafat al-harf wa al-kalimah); yang berada di 96 tempat dan mencakup penambahan harf jarr, dlamir fashl,

Edisi ke-27 Tahun 2008

55

dlamir munfashil setelah lam nafy, lam taukid, mim jama' pada isim isyarah, dan penambahan ha' sakt; (c) Perubahan bentuk susunan kalimat (taghyir tarkib al-jumlah); yang tersebar di 140 tempat dan meliputi perubahan bentuk muannats dan mudzakkar, fungsi harf, posisi harf, dan perubahan dari mukhatab ke muannats; (d) Perubahan urutan kalimat (taghyir tartib aljumlah); yang tersebar di 79 tempat dan meliputi didahulukannya maf'ul (ma'mul) atas fi'il dan fa'il-nya dan didahulukannya muta'alliq (harf jarr) dari muta'allaq fiih; (e) Penggabungan dua huruf atau kata (jam'u al-harfain aw alkalimatain); yang tersebar di 37 tempat dan meliputi penggabungan dua harf dan penggabungan dua kata; (f) Pengulangan kata atau kalimat (tikrar alkalimah aw al-jumlah); yang tersebar di 24 tempat dan meliputi pengulangan isim dhahir, kalimat, kata dan menyambung jama' dengan mufrad pada kata yang sama, dan mengulang fiil; dan (g) Perubahan i'rab (taghyir al-i'rab); yang tersebar di 46 tempat dan meliputi Penggunaan dlamir munfashil untuk sya'n, harf syarat tanpa jawab, am sebagai kata pembuka, kana tanpa khabar, an masdariyah masuk pada fiil amr, athaf pada kata yang jauh, athaf pada makna bukan lafadz, mubtada' dengan isim nakirah, mengawali kata dengan dharaf, penggunaan harf jazm lamma, penggunaan wawu setelah munada mudlaf dan badal terhadap isim nakirah. Adapun efek makna yang ditimbulkan dari unsur-unsur stilistika sintaksis tersebut, yaitu penegasan makna (taukid), kelugasan dan ketegasan dalam pemberian argumen, dan hadirnya nuansa makna yang luas, estetis, dan variatif. 059 Hanafi, Yusuf; Kurniawati, Heti. 2007. Wacana Televisi tentang Mayat dan Kematian dalam Drama Seri Religi (DSR): Kajian Budaya Pemirsa dalam Konteks Islam Populer

Kata-kata kunci: tayangan mistis televisi, drama seri religi (DSR)

Tayangan-tayangan religius di televisi Indonesia mengindikasikan adanya internalisasi nilai-nilai agama yang disuguhkan melalul dunia hiburan (entertainment), seperti sinetron, drama sen, dan acara-acara lain yang sejenis. Acara-acara Drama Seri Religi (DSR) itu telah mendongkrak rating stasiun televisi yang menayangkannya. Kendati demikian, tingginya rating tidak serta-merta menunjukkan bobot kualitas acara yang dimaksud. Rating hanya menunjukkan peningkat banyaknya penonton yang menyaksikan acara tersebut, bukan memperlihatkan bobot kuatitas acaranya. Hampir semua isu dalam DSR dikonstruksi dan sudut pandang mistik. Antusiasme pemirsa terhadap tayangan mistik televisi bertema mayat dan

56

Abstrak Hasil Penelitian

kematian dalam DSR merupakan salah satu alasan mengapa penelitian mi penlu dilakukan. Mengapa anomali-anomali yang terjadi pada jenazah menarik untuk disaksikan? Tidak kalah penting untuk diteliti adalah implikasinya terhadap keberagamaan masyarakat, baik dalam konteks individu, keluarga maupun masyarakat. Penelitian ini ditujukan untuk melihat dampak yang signifikan dari tayangan tersebut. Dampak ini akan dilacak melalui penelitian atas persepsi masyarakat yang diterpa tayangan televisi yang bernuansa mistik ini. Karenanya, penelitian ini pada dasarnya merupakan suatu kaijan atas efek media massa. Kajian ini dilakukan dengan pendekatan kualitatif. Pendekatan kualitatif, tepatnya kualitatif-interpretatif, digunakan untuk memahami isu-isu dibalik fenomena yang terlihat. Hal ini sesuai dengan tujuan penelitian ini, yang dimaksudkan untuk mengetahui persepsi subyek penelitian terhadap pengalaman menonton tayangan mistis televisi bertema mayat dan kematian dalam Drama Seri Religi (DSR). Partisipan yang dipilih untuk penelitian kualitatif ini, sesuai dengan tujuan penelitian, adalah individu yang merepresentasikan masyarakat menengah atas/elit, dan masyarakat menengah bawah/non elit, serta kelompok dewasa dan remaja. Secara umum mengapa dipilih elit dan non elit, karena diasumsikan ada perbedaan cara pandang yang cukup signifikan di antara kedua kelompok masyarakat tersebut terhadap tayangan mistik televisi. Sedangkan perbedaan kajian antara remaja dan orang dewasa ingin melihat persepsi keduanya tentang tayangan mistik, yang nantinya akan terlihat pada efek dan tayangan tersebut. Tempat penelitian yang dipilih adalah Kecamatan Singosari, Malang karena memenuhi kriteria berikut. Pertama, banyak penduduk yang melihat DSR di televisi. Kedua, ada intensitas subyek untuk melihat DSR dan ketiga, terdapat beberapa langkah budaya yang dapat diikuti sebagai Iingkup pembentukan dan tayangan program televisi. Teknik pengumpulan data yang digunakan dalam penelitian ini adalah sebagai berikut: teknik wawancara mendalam (Deep Interview), metode observasi terlibat (Method of Observation fnvolved), metode diskusi kelompok terfokus (Method Focus Group Discussion), Analisis lsi (Content Analysis), dan Studi Literatur. Kesimpulan dari penelitian ini dapat diambil beberapa hal yang menonjol. Pertama, penganuh media pada khalayak tenjadi dalam berbagai tingkatan. Mengacu pada Reception Theory/Decoding dan Stuart Hall, hasil penelitian mengindikasikan hubungan khalayak-media berada pada posisi yang berbeda-beda: hegemonic dominant (tenpengaruh) bagi kalangan menengah ke bawah dan remaja, negotiated (dapat berkompromi), dan

Edisi ke-27 Tahun 2008

57

oppositional (menolak) bagi kalangan menengah atas dan berpendidikan. Kedua persepsi dan sikap memang tampak kuat dipengaruhi faktor budaya, lingkungan, agama, pendidikan dan kepentingan maupun norma-norma lingkungan. Ketiga, mekanisme persepsi selektif menjelaskan perbedaan persepsi di antara khalayak televisi yang terlihat dalam penelitian ini. Namun hasil penelitian ini memperlihatkan, belum tentu golongan yang diasumsikan berpendidikan tinggi dan berekonomi mapan--sehingga memiliki alternatif hiburan di luar televisi--resisten terhadap televisi. Tidak tertutup kemungkinan dia menyukai dan patuh karena nilai-nilai yang dianut. Kelima, salah satu hasil penelitian yang menarik adalah munculnya desensitisasi dan resistensi di antara khalayak televisi. Desensitisasi adalah penumpulan kepekaan diakibatkan karena khalayak terbiasa menyaksikan tayangan mistik televisi yang dipermasalahkan. Resistensi muncul di antara khalayak yang berada pada posisi negotiated dan oppositional reading, menenima, memperhatikan dan menolak dengan cara mengganti saluran. Keenam, konsep rating yang mengasumsikan bahwa program dengan rating tinggi pasti disukai khalayak, perlu dipertanyakan. Sebab khalayak memiliki persepsi berbeda-beda seiring dengan perbedaan latarbelakang budaya, pendidikan, keimanan, umur, dan kematangan diri. Lokasi dimana survai rating dilakukan sangatlah subyektif. Rating-rating tinggi bagi tayangan mistik televisi diperoleh karena survei tersebut dilakukan pada kelas menengah ke bawah dan remaja. 060 Noorliana; Hertanto, Arif. 2007. Kecenderungan Penggunaan Bahasa Inggris dalam Penulisan Iklan di Kotamadya Malang

Kata-kata kunci: penulisan iklan, bahasa Inggris, spanduk, baliho

Berbagai usaha dilakukan para pengusaha untuk membangun, membesarkan dan mempertahankan perusahaan, antara lain dengan memanfaatkan media iklan yang efekifitasnya dipengaruhi bahasa yang digunakan. Penggunaan iklan berbahasa Inggris bagi masyarakat Malang menimbulkan pertanyaan tentang efektifitas iklan. Studi ini mengidentifikasi bentuk-bentuk penggunaan bahasa, bentuk-bentuk kebahasaan, serta kejelasan iklan, dengan metode deskriptif-kualitatif; teks-teks iklan spanduk dan baliho, serta pemotretan dan wawancara merupakan sumber data dan teknik yang digunakan. Hasil penelitian menunjukkan (1) adanya kecenderungan menggunakan campur bahasa Inggris dan bahasa Indonesia pada pola-pola pendek, padat, santai, akrab, dan fleksibel; (2) bentuk-bentuk kebahasaan yang digunakan adalah kata-kata dan frasa pendek dan kalimat dengan satu klausa pendek dalam tiga kategori berpadanan, tidak berpadanan, dan

58

Abstrak Hasil Penelitian

serapan pada kata dan frasa; dan (3) penggunaan bahasa Inggris tidak berpengaruh besar terhadap kejelasan pesan, karena singkat bentuknya, familiar kosakatanya, konteks visual dan pengalaman konkret yang membantu. 061 Cahyowati, E.T.D; Wulandari C. 2007. Penerapan Jurnal Matematika pada Pembelajaran Matematika sebagai Implementasi Kurikulum 2004 di SMP Laboratorium Universitas Negeri Malang

Kata-kata kunci: jurnal Matematika, asesmen alternatif, konstrukstivistik, SMP laboratorium

Paradigma konstruktivistik merupakan dasar dalam mengembangkan Kurikulum 2004. Dampak implementasi kurikulum 2004 yang terkait dengan kegiatan pembelajaran adalah peranan guru sebagai pembimbing, fasilitator, dan evaluator. Penilaian berbasis kelas sangat disarankan oleh kurikulum 2004 dalam kaitannya dengan peran guru sebagai evaluator. Penilaian berbasis kelas dilaksanakan secara terpadu dengan kegiatan belajar mengajar. Oleh karena itu, perangkat penilaian tidak cukup hanya berupa tes tertulis saja. Perangkat penilaian selain tes tertulis diperlukan dalam rangka implementasi penilaian yang berdasarkan kurikulum 2004. Jurnal matematika merupakan salah satu bentuk penilaian alternatif dan berbasis kelas. Melalui jurnal matematika, siswa dimungkinkan dapat mengajukan pendapat mengkomunikasikan ide-idenya dan mengajukan pendapat secara tertulis. Jurnal matematika juga dapat menumbuhkembangkan kemampuan siswa dalam komunikasi tertulis. Pengkomunikasian ide secara tertulis memegang peranan yang penting dalam proses berpikir. Penerapan jurnal matematika sebagai satu kesatuan dalam kegiatan pembelajaran merupakan hal yang baru. Dengan demikian perlu dilaksanakan penelitian tentang penerapan jurnal matematika. Penerapan jurnal matematika dalam penelitian ini menyatu dengan pembelajaran beracuan konstruktivistik. Untuk mengungkap penerapan jurnal matematika, maka dilakukan penelitian ini dan dilaksanakan di SMP Laboratorium UM. Jurnal matematika yang diterapkan pada penelitian ini meliputi jurnal matematika yang terkait dengan aktivitas siswa dan yang terkait dengan refleksi diri siswa. Penelitian ini mempunyai rumusan masalah sebagai berikut (1) Bagaimana penerapan jurnal matematika sebagai asesmen alternatif pada pembelajaran matematika; (2) Apakah jurnal matematika yang diterapkan dapat memfasilitasi siswa dalam pengkonstruksian fakta, prinsip, atau

Edisi ke-27 Tahun 2008

59

konsep matematika; dan (3) Bagaimana kesan siswa dan guru dalam penerapan jurnal matematika Rancangan penelitian ini adalah rancangan penelitian tindakan kelas. Banyaknya siklus pada penelitian ini adalah tiga siklus. Pada silkus pertama memerlukan tiga pertemuan, siklus ke dua memerlukan empat pertemuan dan siklus ke tiga memerlukan satu pertemuan. Siklus pertama merupakan tahap sosialisasi penerapan jurnal matematika. Siklus ke dua merupakan tahap pembiasaan dan siklus ke tiga merupakan tahap penerapan jurnaldengan format tanpa bantuan pengisian. Berdasarkan data yang diperoleh, dapat disimpulkan bahwa: (1) jurnal matematika dapat diterapkan sebagai asesmen alternatif, karena melalui tulisan siswa di jurnal dapat diperoleh informasi tentang hal-hal apa saja yang sudah dikuasai dan apa saja yang belum dikuasai; (2) penerapan jurnal matematika yang terkait dengan aktivitas siswa dapat dilaksanakan terpadu dengan pelaksanaan pembelajaran matematika; (3) kelancaran keterlaksanaan jurnal matematika sebagai asesmen alternatif dapat dipengaruhi oleh kondisi kelas, tingkat kesulitan materi, dan format tugas jurnal matematika; (4)penerapan jurnal matematika dapat memfasilitasi pengkonstruksian pengetahuan matematika siswa; dan (5) siswa dan guru keduanya memberikan kesan positif terhadap penerapan jurnal matematika karena dengan jurnal matematika siswa diberi kesempatan untuk mengingat pelajaran yang terjadi saat itu, membuat contoh sendiri tentang suatu topik matematika, mengetahui kelebihan dan kelemahan dalam belajar matematika, dan memikirkan cara mengatasi kesulitan belajar matematika. Berdasarkan hasil penelitian ini, dapat diajukan saran sebagai berikut: (1) sebaiknya dikembangkan penelitian tentang jurnal matematika dengan kondisi siswa yang berbeda dari penelitian ini dan (2) pada tahap sosialisasi sebaiknya tanpa melalui model jurnal yang hanya menjawab pertanyaan, melainkan dapat langsung pada model yang redaksi kalimatnya sudah disusun guru sedangkan siswa tinggal melengkapi. 062 Hidayah, Indriyati Nurul; Irawati, Santi. 2007. Penggunaan Kalkulator Grafik dalam Pembelajaran Matematika dan Pengaruhnya pada Kemampuan Pemahaman Konsep dan Penalaran Mahasiswa Matematika

Kata-kata kunci: kalkulator grafik, kemampuan pemahaman konsep, kemampuan penalaran

60

Abstrak Hasil Penelitian

Pada umumnya mahasiswa kurang peduli pada aspek penalaran dan pemahaman konsep. Mahasiswa lebih merupedulikan untuk mendapatkan hasil akhir. Hal itu diduga kuat sebagai akibat dan metode pembelajaran matematika yang diperoleh mahasiswa ketika mereka masih menjadi siswa. Model perkuliahan yang mencerminkan inovasi dalam pembelajaran matematika, seperti penggunaan kalkulator grafik ini, diperlukan mahasiswa Prodi Pendidikan Maternatika, karena beberapa penelitian mengindikasikan perlunya latihan dan pengalaman tersebut. Tujuan penelitian ini adalah: (I) mendesain pretotipe bahan ajar (hand out, semacam petunjuk praktikum) untuk membantu perkuliahan Kalkulus I dengan rnemanfaatkan kalkulator grafik sebagai media peinbelajaran; (2) Mendesripsikan tanggapan/pendapat mahasiswa pada implementasi perkuliahan Kalkulus I dengan rnenggunakan kalkulator grafik sebagai media pembelajaran; (3) Menguji ada tidaknya perbedaan kemampuan penalaran antara mahasiswa di kelas dengan model perkuliahan yang menggunakan kalkulator grafik sebagai media pembelajaran dengan rnahasiswa pada model perkuliahan konvensional; dan (4) Menguji ada tidaknya perbedaan kemampuan pemahaman konsep antara mahasiswa di kelas dengan model perkuliahan yang menggunakan kalkulator grafik sebagai media pembelajaran dengan mahasiswa pada model perkuliahan konvensional. Hasil penelitian ini adalah: (1) dihasilkah prototipe bahan ajar (hand out, semacam petunjuk praktikum) untuk membantu perkuliahan Kalkulus I dengan mernanfaatkan kalkularor grafik sebagai media pcmbelajaran; (2) Mahasiswa merasa senang dengan perkuliahan Kalkulus I dengan mnenggunakan kalkulator grafik sebagai media pembelajaran; (3) ada perbedaan kemampuan penalaran antara mahasiswa di kelas dengan model perkuliahan yang menggunakan kalkulator grafik sebagai media pembelajaran dengan mahasiswa pada model perkuliahan konvensional; dan (4) ada perbedaan kemampuan pemahaman konsep antara mahasiswa di kelas dengan model perkuliahan yang menggunakan kalkulator grafik sebagai media pembelajaran dengan mahasiswa pada model perkuliahan konvensional. Temuan lain dari basil penelitian ini adalah ternyata dengan kalkulator grafik mahasiswa dapat mengembangkan beberapa konsep yang ada di bahan ajar dan mahasiswa menginginkan pembelejaran seperti ini untuk materi-materi yang lain. 063 Lestari, Sri Rahayu; Balqis; Wulandari, Nuning. 2007. Pengaruh Perasan Umbi bawang Putih (Allium sativum L.) Lanang yang

Edisi ke-27 Tahun 2008

61

Dibudidayakan di Kawasan Taman Nasional Bromo Tengger Semeru terhadap Kadar Testosteron dan Kecepatan Spermatogenesis Tikus (Rattus norvegicus) Pradewasa

Kata-kata kunci: perasan umbi bawang putih lanang, RIA, testosteron

Bawang putih (Allium sativum, L.) sering digunakan masyarakat sebagai obat terutama umbi bawang lanang karena dianggap lebih berkhasiat. Bawang putih (Allium sativum, L.) lanang yang dibudidayakan di Taman Nasional Bromo, Tengger, Semeru (TNBTS) diduga dapat meningkatkan kadar testosteron mencit jantan pradewasa. Tujuan dari penelitian ini adalah untuk mengetahui pengaruh perasan bawang putih (Allium sativum L.) lanang yang dibudidaykan di TNBTS terhadap kadar testosteron mencit (Mus musculus) Pradewasa galur A/J. Penelitian ini merupakan penelitian eksperimen dengan Rancangan Acak Lengkap (RAL). Sebagai perlakuan dalam penelitian ini adalah kadar testosteron dengan 5 ulangan Pemberian perasan bawang putih lanang dilakukan selama 21 hari sebanyak 0,5 ml secara oral dengan alat gavage. Dosis yang digunakan adalah Perlakuan I = 0 (kontrol), dan berturut-turut perlakuan II, III IV, V adalah 5%,10%,15%,20%. Data kadar testosteron diperoleh melalui deteksi dengan Radio Imuno Assay (RIA) selanjutnya data dianalisis dengan Anava satu jalur sedangkan irisan mikroanatomi testis di analisis secara deskriptif. Hasil penelitian menunjukkan bahwa perasan bawang putih (Allium sativum. L) lanang yang dibudiyakan di TNBTS tidak berpengaruh terhadap kadar testosteron mencit pradewasa Galur A/J. Sedangkan irisan mikroanatomi testis menunjukkan spermatozoa sudah terbentuk dan siap dilepaskan pada perlakuan III, IV dan V. 064 Suryanto, Heru; Aminudin. 2007. Karakteristik Mekanis Baja Karbon Rendah dengan Struktur Dual Phase

Kata-kata kunci: anil temperatur kritis, Struktur Dualphase, martensit, ferit

Upaya untuk mengoptimalkan sifat-sifat mekanis dari baja karbon rendah adalah dengan mengoptimalkan pembentukan struktur martensit dalam matriks ferit sehingga memiliki struktur dual phase. Struktur dualphase dapat diperoleh dengan menggunakan proses perlakuan panas anil temperatur kritis. Tujuan penelitian yang ingin dicapai adalah untuk menemukan: pengaruh variasi suhu dalam proses anil temperatur terhadap kekerasan dan struktur mikro baja karbon rendah. Metode penelitian yang digunakan adalah

62

Abstrak Hasil Penelitian

ekperimen laboratorium. Spesimen berupa baja ST-60, diproses dengan o perlakuan anil temperatur kritis dengan variasi suhu 740, 760, dan 780 C, holding time 15 menit, selanjutnya spesimen dilakukan uji kekerasan dan mikro struktur. Hasil penelitian menunjukkan bahwa peningkatan temperatur proses anil temperatur kritis memberikan peningkatan kekerasan dari baja dengan kekerasan maksimum 53,9 HRc. Pengamatan mikrostruktur mikro dari baja ST-60 yang mengalami proses anil temperatur kritis memiliki struktur dominan ferit dan martensit, yang tampak melalui warna dan bentuk strukturnya. 065 A.P., Afwan Hariri; Churiyah, Madziatul. 2007. Prospek Badan Usaha Milik Desa (Bumdes) dalam Pemberdayaan Masyarakat dan Penanggulangan Kemiskinan di Kecamatan Wagir Kabupaten Malang

Kata-kata kunci: Badan Usaha Milik Desa (BUMDes), pemberdayaan masyarakat, penanggulangan kemiskinan

Berbagai upaya penanggulangan kemiskinan telah banyak dilakukan oleh Pemerintah dengan menggunakan berbagai pendekatan. Paradigma terkini yang dikembangkan dalam penanggulangan kemiskinan adalah melalui Pemberdayaan Masyarakat dengan skema bantuan dana bergulir bagi pengembangan usaha ekonomi produktif bagi warga miskin. Pendekatan tersebut dipilih karena salah satu permasalahan kemiskinan yang paling utama adalah keterbatasan akses permodalan bagi rumah tangga miskin. Salah satu implementasi dari pendekatan tersebut adalah dengan memfasilitasi pendirian lembaga-lembaga keuangan mikro yang bernama Unit Pengelola Keuangan (UPK) pada level desa/kelurahan. Beberapa program pengentasan kemiskinan yang mengimplementasikan pola kredit mikro adalah PPK, P2KP dan Gerdu Taskin. Diantara program tersebut, Gerdu Taskin bahkan telah mengembangkan desain peningkatan kelembagaan UPK menjadi Badan Usaha Milik Desa (BUMDes). Desain yang dikembangkan dalam UPK Gerdu Taskin berpotensi untuk dikembangkan menjadi BUMDes dan memiliki prospek bagi upaya pemberdayaan masyarakat dan penanggulangan kemiskinan. Pembagian alokasi keuntungan bagi pengembangan modal usaha produktif, pembiayaan program pemberdayaan lingkungan serta pembiayaan program-program sosial merupakan indikasi peran yang dapat dioptimalkan dalam rangka pemberdayaan masyarakat dan penanggulangan kemiskinan.

Edisi ke-27 Tahun 2008

63

066 Winarno, Agung. 2007. Pembelajaran Nilai-nilai Kewirausahaan: Pendekatan Fenomenologis pada SMK Negeri 3 Malang

Kata-kata kunci: internalisasi, nilai-nilai kewirausahaan, fenomenologis

Menyadari arti penting kewirausahaan ini, maka peran lembaga pendidikan menjadi strategis, pendidikan harus mampu berperan aktif dalam menyiapkan sumberdaya manusia terdidik dengan membekali peserta didiknya tidak hanya kemampuan akademis dan keterampilan teknis tetapi harus juga menginternalisasi nilai-nilai kewirausahaan sebagai bagian dari bekal dalam menghadapi berbagai tantangan hidup baik sebagai individu maupun sebagai bagian dari komunitas. Tujuan dari penelitian ini adalah untuk menjawab pertanyaan (1) Bagaimana nilai-nilai kewirausahaan siswa sebelum terlibat dalam proses pembelajaran di sekolah; (2) Bagaimanakan suatu proses pembelajaran di sekolah dalam rangka internalisasi nilai-nilai kewirausahaan; dan (3) Bagaimana evaluasi dilakukan untuk mengetahui keberhasilan proses internalisasi nilai-nilai kewirausahaan pada diri siswa. Hasil Penelitian menunjukkan bahwa tiap individu memiliki bakat bawaan yang berbeda dengan individu lain meski lahir dan hidup dalam satu keluarga, bakat-bakat itu lebih banyak terkait dengan minat dan keterampilan tertentu bukan yang menyangkut nilai-nilai. Pada umunya nilai-nilai kewirausahaan dari siswa sebelum terlibat dalam proses pembelajaran di sekolah bersifat abstrak (laten),yang berupa nilai kepercayaan diri dan motivasi yang bersumber dari pembelajaran di keluarga namun belum sampai pada tingkatan kesadaran.. Kewirausahaan yang dipahami oleh Pengelola dan guru adalah terkait dengan kemampuan membuka dan mengelola usaha (kebisnisan) setelah lulus sekolah, pemahaman ini kemudian diimplementasikan berupa pemadatan dan pengayaan matadiklat produktif. Dengan demikian tidak ditemukan secara khusus pembelajaran yang terkait dengan peningkatan nilai-nilai kewirausahaan siswa selain pengetahuan tentang kebisnisan juga belum memadai kecuali kecakapan vokasionalnya.. Evaluasi keberhasilan pembelajaran kelas wirausaha yang menekankan kepada omzet penjualan yang dicapai siswa, berpengaruh terhadap terabaikannya evaluasi yang menyangkut dengan perkembangan nilai-nilai kewirausahaannya. Nilai yang relatif dapat dikonstruk dalam proses pembelajaran adalah nilai kepercayaan diri yang terbangun dari semakin meningkatnya kemampuan mereka dibidang keterampilan berproduksi (vokasional) dan kecakapan akademik yang dimiliki, kepercayaan diri merupa-

64

Abstrak Hasil Penelitian

kan nilai utama dalam nilai-nilai kewirausahaan yang berpotensi dapat menumbuhkan nilai-nilai lainnya seperti kreativitas, motivasi, pengambil risiko serta kepemimpinan. Terdapat fenomena degradasi nilai kewirausahaan pasca lulus sekolah yakni pembelajaran di keluarga. Alumni yang memulai usaha di rumah dan memiliki jenis usaha yang sama dengan orang tuanya, cenderung terjadi degradasi nilai kewirausahaan yakni semakin lama semakin ada kecenderungan penurunan atas nilai-nilai terminal kewirausahaan seperti daya kreartifitas, motivasi, dan sikap terhadap risiko. Hal ini tidak terjadi pada alumni yang membuka usaha berbeda dengan orang tuanya, nilai-nilai terminal kewirausahaan mengalami kontruksi positip. Untuk alumni yang orang tuanyanya bukan dari kalangan wirausaha nilai-nilai itu tidak banyak menglami perubahan setidaknya selama masa lulus sampai penelitian berlangsung. Berdasarkan hasil penelitian itu, di rekomendasikan bahwa penyempurnaan kurikulum dan skenario pembelajaran nilai perlu penyempurnaan, pelibatan keluarga dalam peningkatakan nilai kewirausahaan juga perlu dilakukan terutama keluarga yang memiliki jenis usaha yang sama dengan anak. 067 Sumanto, Agus; Nasikh. 2007. Analisis Determinasi Sosial-Ekonomi Migrasi Tenaga Kerja (Studi pada Ibu Rumah Tangga yang Bekerja dari sektor Pertanian ke Sektor Non Pertanian di Kecamatan Singosari Kabupaten Malang)

Kata-kata kunci: sosial ekonomi, tenaga kera, sektor pertanian

Penelitian ini bentujuan untuk menganalisis (1) faktor-faktor yang mempengaruhi ibu rumah tangga bekerja pada sektor non pertanian dan (2) mengetahui kontribusi pendapatan ibu rumah tangga terhadap pendapatan keluarga di Desa Dengkol, Kecamatan Singosari, Kabupaten Malang. Penelitian ini dilakukan dengan metode survey dan data dianalisis dengan menggunakan model logit dan deskriptif. Hasil penelitian ini menunjukkan bahwa enam faktor yang mempengaruhi ibu rumah tangga bekerja pada sektor non pentanian yaitu: upah di sektor non pertanian, tingkat pendidikan dan jumlah orang yang menjadi tanggungan keluarga yang berkorelasi secara positif terhadap kemungkinan (probabilitas) untuk bekerja di sektor non pertanian serta faktor luas lahan yang dimiliki, pendapatan keluarga dan upah di sector pertanian, yang berkorelasi secara negatif terhadap kemungkinan (probabilitas) untuk bekerja di sektor non pertanian.

Edisi ke-27 Tahun 2008

65

Sedangkan rata-rata persentase sumbangan pendapatan ibu rumah tangga terhadap pendapatan keluarga di Desa Dengkol sebesar 122%. Dan besarnya sumbangan pendapatan ibu rumah tangga tersebut, maka sebenarnya pendapatan ibu rurnah tangga tidak dapat dikatakan sebagai pendapatan tambahan melainkan sebagai sumber pendapatan keluarga yang utama. 068 Wulandari, Dwi; Inayati, Ro'ufah. 2007. Penentuan Modal Inflasi Kota Malang

Kata-kunci kunci: inflasi, pertumbuhan ekonomi, nilai tukar mata uang

Dalam pembangunan daerah salah satu kestabilan makroekonomi dapat dilihat dari besanya tingkat inflasi yang terjadi. Inflasi merupakan fenomena yang senantiasa terjadi dalam dalam perekonomian. Dalam konteks makro ekonomi, fluktuasi dalam angka inflasi mencerminkan perkembangan yang berfluktuatif pula pada tingkat harga yang terjadi. Pada sisi mikro ekonomi, fluktuasi harga tersebut akan sangat menentukan perilaku masyarakat dalam membelanjakan uangnya di pasar. Apabila fluktuasi harga mengarah pada kenaikan harga secara tajam, maka konsumen akan mengalami penurunan daya belinya. Sebaliknya apabila fluktuasi harga yang ada cenderung mengarah pada penurunan harga, maka konsumen akan merasakan peningkatan daya terhadap belinya. Perkembangan angka inflasi di Kota Malang menunjukkan suatu perkembangan yang dinamis. Kondisi ini dapat dipahami mengingat Kota Malang merupakan kota dengan tingkat pertumbuhan ekonomi cukup tinggi. Tingginya pertumbuhan ekonomi ini sebagian besar ditopang oleh perkembangan di sektor jasa dan industri. Pertumbuhan ekonomi yang tinggi tersebut pada akhirnya akan berdampak pada semakin meningkatnya pendapatan masyarakat. Pendapatan masyarakat yang semakin meningkat akan mendorong laju inflasi di Kota Malang. Penelitian ini bertujuan untuk menganalisis faktor-faktor apa yang menentukan tingkat inflasi di Kota Malang selama tahun 1997-2005. Metode analisis data yang digunakan adalah model regresi dengan pendekatan ordinary least square (OLS). Hasil penelitian ini memberikan kesimpulan bahwa inflasi di Kota Malang tidak dipengaruhi oleh jumlah uang beredar, nilai tukar kurs Rp/US$, pengeluaran pembangunan dan PDRB.

66

Abstrak Hasil Penelitian

069 Sidharta, Eka A.; Sulastri. 2007. Analisis Kinerja Keuangan Pemda dengan Pendekatan Analisis Rasio Keuangan pada Anggaran Pendapatan dan Belanja Daerah (APBD) di Kota Malang

Kata-kata kunci: analisis rasio keuangan, APBD

Dalam rangka penyelenggaran otonomi daerah, pemerintah daerah diberikan kewenangan yang luas dalam menyelenggarakan semua urusan pemerintahan. Pengelolaan keuangan daerah yang dituangkan dalam bentuk APBD adalah salah satu aspek pelaksanaan otonomi daerahyang harus dilaksanakan secara efektif dan efisien sehingga bisa dipengaruhi pada kesejahteraan masyarakat. Berdasarkan hal tersebut, APBD dapat dijadikan sebagai tolok ukur dalam penilaian kinerja keuangan pemerintah daerah. Penilaian kinerja keuangan daerah dapat dilakukan dengan analisis rasio keuangan. Penelitian ini bertujuan untuk menilai kinerja keuangan Pemerintah Kota Malang. Penelitian ini merupakan penelitian deskriptif dengan riset jenis studi kasus (kasus studi). Pengumpulan Data Teknik yang adalah metoda dokumentasi dengan menganalisa data secara induksi pada APBD tahun 2003--2005. Alat analisisnya menggunakan Rasio Kemandirian Keuangan Daerah, Rasio Efektivitas PAD, Rasio Efektivitas Pajak Daerah, Derajat Kontribusi BUMD, Analisis Pertumbuhan Belanja, Rasio Efisiensi Belanja, dan Analisis Sisa Lebih Pembiayaan Anggaran (SILPA). Hasil analisa diketahui bahwa Rasio Kemandirian Pemerintah Kota Malang yaitu 15,44% pada tahun 2003; 16,44% pada tahun 2004 dan 15,68% pada tahun 2005. Rasio Efektivotas PAD Pemerintah Kota Malang pada tahun 2003 sebesar 120,9%; 125,9% pada tahun 2004 dan 116,3% pada tahun 2005. Rasio Efektivitas Pajak Daerah Pemerintah Kota Malang yaitu 102,1% pada tahun 2003; 130,6% pada tahun 2004 dan 114,7% pada tahun 2005. Derajat kontribusi BUMD dalam mendukung PAD masih relatif kecil karena pda tahun 2003 hanya mencapai 6, 54% dari keseluruhan PAD; 9,69% pada tahun 2004 dan 8,36% pada tahun 2005. Pertumbuhan belanja Pemerintah Kota Malang cenderung naik, yaitu 13,6% pada tahun 2003; 6,72% pada tahun 2004 dan 0,16% pada tahun 2005. Sebagian besar pendapatan daerah Pemerintah Kota Malang dialokasikan untuk belanja publik yaitu 78% pada tahun 2003; 76,68% pada tahun 2004 dan 74,67% pada tahun 2005. Rasio Efisiensi Belanja Pemerintah Kabupaten Malang yaitu 93,1% pada tahun 2003; 95,54% pada tahun 2004 dan 92,5% pada tahun 2005. Sedangkan Analisis SILPA, kinerja anggaran Pemerintah Kota

Edisi ke-27 Tahun 2008

67

Malang bisa dikategorikan baik karena dari tahun ke tahun masih terdapat SILPA. Berdasarkan hasil analisis data tersebut di atas, dapat diketahui bahwa Pemerintah Kota Malang menunjukkan kinerja yang cukup baik dilihat tingkat efektivitas, efeisiensi dan pencapaian realisasi. Sedangkan dilihat dari kemandirian keuangan daerah, menunjukkan kinerja yang maksimal. Disarankan agar Pemerintah Kota Malang belum menunjukkan kinerja yang maksimal. Disarankan agar Pemerintah Kota Malang meningkatkan PAD secara intensifitasi dan ekstensifikasi, meminimalkan pengeluaran daerah, dan memiliki kemauan yang kuat dalam melaksanakan strategi disertai dengan manajemen yang sempurna dalam pengelolaan keuangan daerah. 070 Siswanto, Ely; Maharani, Satia Nur. 2007. Strategi Pengembangan Lembaga Keuangan Mikro Syariah (BMT-Baitul Mal Wa Tamwil) dalam Memberdayakan Potensi Usaha Kecil

Kata-kata kunci: BMT, usaha kecil, lembaga keuangan mikro

Penelitian ini bertujuan untuk mengidentifikasi dan menganalisis model BMT yang dapat memberdayakan potensi usaha kecil dan untuk mengetahui upaya yang bisa dilakukan agar BMT berhasil dalam memberdayakan potensi usaha kecil menengah. Metode penelitian yang digunakan dalam penelitian ini adalah penelitian deskriptif. Tujuan dari penelitian deskriptif adalah untuk membuat deskripsi, gambaran, atau lukisan secara sistematis, faktual dan akurat mengenai fakta-fakta, sifat-sifat, serta hubungan antar fenomena yang diselidiki. Berdasarkan uraian pada laporan penelitian ini dapat disimpulkan bahwa strategi pengembangan BMT berorientasi pada kekuatan keuangan (Financial viability), Institutional soundness dan efek sosial. Hal ini tentu saja harus didukung dengan kemampuan analisa fiqh dan ekonomis yang memadai, serta di dorong dengan kekuatan sumber daya yang cukup. Di sisi internal penguatan institusi yang dilakukan pada manajerial dan pengelolaan keuangan harus ditingkatkan untuk memajukan efisiensi BMT dalam pembiayaan kredit bagi sektor kecil menengah. Penyelenggaraan fungsi manajerial BMT harus merefleksikan kompetensi yang kuat atas keadaan komunitas sekitarnya, sehingga dengan pembinaan hubungan yang baik tersebut dapat diharapkan penterjemahan strategi yang tepat bagi pengembangan BMT. Hal ini diimbangi dengan pengembangan aspek paradigmatic, mengenai aspek bisnis islami sekaligus

68

Abstrak Hasil Penelitian

meningkatkan muatan-muatan Islam dalam setiap perilaku pengelola dan karyawan BMT dengan masyarakat pada umumnya dan klien pada khususnya. Dalam menghadapi persepsi masyarakat yang rnasih rendah akan keinampuan BMT dan eksistensinya dalam memfasilitasi pembiayaan kredit merupakan hambatan serta tantangan yang harus diantisipasi dengan baik. Sehiugga setiap BMT harus konsisten untuk terus melakukan sosialisasi dan strategi pemasaran baik. Selain itu BMT juga dituntut untuk selain berkompetisi dengan baik, dan aktif dalam inenunjukan eksistensinya dalarn pembiayaan kredit bagi usaha keciL Kami menginventarisir beberapa hal yang harus difahami dengan baik oleh BMT agar mampu bertahan dan konsisten dalam pembiayaan kredit bagi usaha kecil. Hal tersebut antara lain: (1) Implementasi prinsip-prinsip syariah yang utuh; (2) Karakteristik pasar keuangan informal yailg dominan dengan asymetri informa Lion dan biaya transaksi yang tinggi; dan (3) Kemampuan analisa fiqh dan ekonomis yang baik, untuk mendukung operasional BMT dalam proses dan penyediaan skim pembiayaan yang tepat bagi nasabah Kemajuan dan keberlanjutan BMT sesungguhnya merupakan keadaan yang dapat terealisasi, apabila pihak pengelola BMT mampu untuk konsisten dalam melakukan strategi yang aktif dalam menyediakan skim pembiayaan yang tepat bagi keperluan klien. Hal ini merupakan proses yang membutuhkan waktu yang lama dan pengorbanan sumber daya yang besar, serta harus berorientasi pada pemahaman serta konsistensi terhadap aplikasi uklzuwah islanziyali. 071 Rahmawati, Farida; Sumarsoono, Hadi. 2007. Analisis Kemandirian Otonomi Daerah (Studi Kasus Di Kota Malang Tahun 2000-2004)

Kata-kata kunci: pendapatan asli daerah, kapasitas fiskal, kebutuhan fiskal

Penelitian ini ditujukan untuk mengidentifikasikan derajat desentralisasi otonomi daerah kota Malang,serta mengetahui pola dan struktur derajat desentralisasi fiskal dengan menggunakan alat analisis selisih indeks kapasitas fiskal terhadap kebutuhan fiskalnya. penelitian ini menunjukkan bahwa daerah kota Malang memiliki derajat desentralisasi fiskal cukup baik, diatas rata-rata nasional sebesar 5%. Daerah kota Malang memiliki pertumbuhan PAD yang cukup baik. Analisis elastisitas PAD menunjukkan bahwa nilai elastisitas PAD relatif kecil, meskipun secara absolut menunjukkan angka yang cukup tinggi.

Edisi ke-27 Tahun 2008

69

Sedangkan analisis tren PAD menunjukkan pertumbuhannya positif, dimana pmenunjukkan pendapatan asli daerah kota Malang semakin besar dari tahun ke tahun. Kondisi ini menggambarkan bahwa pergerakan ekonomi di tingkat produksi (PDRB) cukup tinggi, di atas pertumbuhan PAD. Hal ini tidak terlepas adanya perubahan paradigma Pemerintah Kota Malang dalam mengelola keuangan daerah. Pemerintah kota Malang cenderung mengurangi perda yang memberatkan investasi, perda yang baru lebih bernuansa insentif terhadap investasi lokal. Dalam konteks pengelolaan keuangan daerah, hal itu menunjukkan langkah kebijakan yang benar dan tepat bagi kondisi pembangunan daerah. 072 Agustin, Grisvia; Mukhlis, Imam. 2007. Peranan APBN dalam Meningkatkan Kesejahteraan Masyarakat Indonesia

Kata-kata kunci: kesejahteraan, otonomi daerah, indeks pembangunan manusia

Era otonomi daerah telah menyebabkan perkembangan perekonomian nasional mengalami perubahan dalam mekanisme kebijakan pembangunannya. Dengan model perencanaan pembangunan yang bersifat Bottom Up diharapkan adanya partisipasi yang aktif dari masyarakat dalam pembangunan. Salah satu tujuan dalam pembangunan tersebut adalah tercapai kesejahteraan hidup bagi masyarakat Indonesia. Meskipun demikian, kesejahteraan yang diukur dari angka Indeks Pembangunan Manusia (IPM) memerlukan segenap sumber daya yang tersedia. Dalam hal ini kemampuan keuangan negara yang tercermin dalam komponen APBN sangat penting untuk terus ditingkatkan demi peningkatan dalam kesejahteraan masyarakat. Penelitian ini berujuan untuk menganalisis faktor-faktor yang mempengaruhi kesejahteraan masyarakat Indonesia berdasarkan kemampuan anggaran (APBN). Komponen dalam APBN tersebut seperti penerimaan pajak, penerimaan bukan pajak dan komponen pengeluarannya adalah Dana Alokasi (DA) selama tahun 1995-2004. Guna menjawab pertanyaan tersebut, metode analisis yang digunakan adalah Metode Ordinary Least Square (OLS) dengan menerapkan model regresi dinamis dengan pendekatan Partial Adjustmen Model (PAM). Berdasarkan model analisis yang dikembangkan, penelitian ini memberikan kesimpulan bahwa baik dari komponen pengeluaran maupun penerimaan dalam APBN belum memberikan kontribusi yang signifikan terhadap tingkat kesejahteraan masyarakat Indonesia. Hasil penelitian ini memberikan justifikasi bahwa kemampuan

70

Abstrak Hasil Penelitian

anggaran pemerintah belum mampu meningkatkan kesejahteraan masyarakat Indonesia. 073 Sumarsono, Hadi; Wulandari, Dwi. 2007. Studi Penetapan dan Pengembangan Sektor Unggulan Daerah Kota Batu Tahun 2006 (Pendekatan Metode Matriks Tipologi Klassen)

Kata-kata kunci: tipolocti kiassen, sektor unggulan, sektor potensial

Penelitian ini ditujukan untuk mengidentifikasi kegiatan ekonomi potensial, serta mengetahui pola dan struktur pertumbuhan ekonomi di daerah Kota Batu selama tahun 2006 dengan menggunakan alat analisis klassen. Penelitian ini menunjukkan bahwa daerah Kota Batu memiliki kegiatan unggulan pada sektor pertanian dan jasa, sedangkan sektor perdagangan, hotel dan restoran merupakan sektor yang maju. Sedangkan enam sektor yang lain termasuk sektor berkembang cepat. Pengaruh bauran pertumbuhan sektor pertanian, jasa, perdagangan, hotel dan restoran sangat dominan untuk daerah Kota Batu. Hal ini dikarenakan untuk sektor maju, yaitu perdagangan, hotel dan restoran mempunyai proporsi 45,77% terhadap PDRB dengan laju pertumbuhan 9,6% tahun, sedangkan untuk sektor unggulan yaitu pertanian mempunyai proporsi 21,51% dengan laju pertumbuhan 13,02.% tahun dan jasa sebesar 13,47% dengan laju pertumbuhan 2l,54%. Sektor perdagangan, hotel, dan restoran menjadi sektor yang maju dengan pertumbuhan di bawah rata-rata daerah kota Batu karena selama periode tahun 2006 mengalami penurunan kunjungan wisata dan daerah surabaya dan sekitar karena adanya bencana Lapindo. Untuk mengatasinya harus dilakukan peningkatan kegiatan promosi melalui even-even pameran baik di tingkat daerah, nasional, maupun internasional 074 Nasikh; Dewi, Titis Shinta. 2007. Analisis Perilaku Kepemimpinan, Pengaturan Tugas dan Hubungan Manusiawi para Kepala Biro dengan Keefektifan Kerja Pegawai Administrasi dan Perguruan Tinggi Swasta Malang

Kata-kata kunci: gaya kepemimpinan demokratis, pengaturan tugas, hubungan manusiawi, keefektifan kerja

Perguruan tinggi swasta (PTS) sebagai salah satu lembaga pendidikan yang diharapkan mampu menghasilkan sumber daya manusia yang

Edisi ke-27 Tahun 2008

71

berkualitas, dituntut untuk selalu memperbaiki semua sumber daya yang dimiliki. Berkenaan dengan itu, penulis sangat tertarik untuk melihat pengaruh antara gaya kepemimpinan demokratis, pengaturan tugas dan hubungan manusiawi para kepala biro dengan keefektifan kerja pegawai administrasi Perguruan Tinggi Swasta Malang. Sasaran atau subyek penelitian adalah pegawai administrasi, sehingga unit analisis dalam penelitian mi adalah pegawai administrasi. Penelitian dilakukan di enam PTS Malang, yaitu UMM, Unmer, ITN, Unisma, Widyagama, dan Unidha. Hasil penelitian ini menunjukkan, ada pengaruhi signifikan antara gaya kepemimpinan demokratis, pengaturan tugas dan hubungan manusiawi para kepala biro dengan keefektifan kerja pegawai administrasi. Pengaruh antara variabel bebas tersebut, yaitu: gaya kepemimpinan demokratis (XI), pengaturan tugas (X2) dan hubungan manusiawi para kepala biro (X3) dengan variabel terikat, keefektifan kerja pegawai administrasi (Y), baik secara parsial maupun simultan memang berpengaruh (signifikan). mi artinya, bila mana variable bebas (Xl, X2, dan X3) tersebut mengalami peningkatan (perbaikan), maka akan dapat meningkatkan keefektifan kerja pegawai administrasi Perguruan Tinggi Swasta Malang (Y). Begitu sebaliknya, bila mana variable bebas (Xl, X2, dan X3) tersebut mengalami penurunan, maka akan dapat menurunkan keefektifan kerja pegawai administrasi Perguruan Tinggi Swasta Malang (Y). 075 Handayati, Puji; Laksiani, Tri. 2007. Implementasi Corporate Social Responbility sebagai Upaya Mengatasi Konflik Saluran Udara Ekstra Tinggi (SUTET) (Studi Kasus pada PLN Kota Malang)

Kata-kata kunci: PLN, konflik Saluran Udara Ekstra Tinggi (SUTET)

Penelitian ini bertujuan (1) Untuk mengetahui penerapan Corporate Social Responsibility (CSR) pada PT. PLN (Persero) dalam mengatasi masalah Saluran Udara Tegangan Ekstra Tinggi (SUTET) dan (2) Untuk mengetahui bentuk Corporate Social Responsibility (CSR) yang dapat mengatasi konflik Saluran Udara Tegangan Ekstra Tinggi (SUTET). Berdaasarkan jenis data dan analisis yang digunakan, jenis penulis-an ini adalah penulisan deskriptif, dimana menurut Saifudin Azwar (1998:7), penelitian deskriptif adalah penelitian yang menggambarkan secara sistematik dan akurat fakta dan karakteristik mengnai populasi atau bidang tertentu. Penulisan ini berusaha menggambarkan situasi dan kejadian tentang Saluran Udara Tegangan Ekstra Tinggi (SUTET). Data yang dikumpulkan bersifat deskriptif sehingga tiddak bermaksud mencari

72

Abstrak Hasil Penelitian

penjelasan, menguji hipotesis, membuat prediksi maupun mempelajari implikasi. Penulisan ini dimaksud untuk mendeskripsikan mengenai penerapan CSR dalam mengatasi konflik SUTET. Data yang diperoleh dianalisis secara kualitatif. Menurut Subagyo (1997:106) analisis kualitatif adalah analisis yang dilakukan terhadap data yang berupa informasi, uraian dalam bentuk bahasa prosa kemudian dikaitkan dengan data lainnya untuk mendapatkan kejelasan terhadap suatu kebenaran sehingga memperoleh gambaran baru. Analisis ini bertujuan untuk memberikan deskripsi mengenai subjek penelitian berdasarkan data dari kelompok subjek yang diteliti. Akhir-akhir ini banyak perusahaan yang makin sadar akan pentingnya praktik Corporate Social Responsibility (CSR), ataupun mengikuti langkah-Iangkah serupa termasuk perusahaan BUMN seperti PT. PLN (Persero). Hal Ini tentu memerlukan hubungan kerjasama yang baik antara pemerintah, masyarakat dan para pelaku bisnis sendiri. Misalnya, pemerintah memberikan insentif pajak bagi perusahaan yang menerapkan program CSR secara serius. Demikian pula Bapepam mewajibkan laporan CSR bag) perusahaan yang akan masuk bursa ataupun yang kini sudah tercatat di bursa, serta langkah-langkah lain yang relevan. Dan masyarakat mendukung program CSR yang diterapkan perusahaan tersebut. Dalam menjalankan operasinya sebagai penyedia jasa ketenagalistrikan, PT. PLN harus memperhatikan tanggung jawab sosial perusahaan seperti yang terjadi pada konflik SUTET. Sehingga setiap keputusan yang diambil dan tindakan yang dilaksanakan harus mempunyai tanggung jawab sosial. Agar program CSR dapat berjalan dengan baik, maka disarankan sebagai berikut: (1) Untuk pemerintah sebaiknya memberikan peraturan hukum yang secara tegas dan khusus mengatur tentang tanggung jawab sosial perusahaan; (2) Program diarahkan pada masyarakat yang membutuhkan dan diprioritaskan pada kebutuhan pokok masyarakat untuk meningkatkan kualitas hidup; (3) Program dilaksanakan dengan menyediakan tenaga ahli pendamping; dan (4) Dilakukan evaluasi dan pelaporan, apakah program tersebut berjalan sesuai tujuan. 076 Inayati, Ro'ufah; Agustin, Grisvia. 2007. Analisis Distribusi Pendapatan Propinsi Jawa Timur

Kata-kata kunci : distribusi pendapatan daerah, Indeks Theil, Indeks L, profil daerah

Edisi ke-27 Tahun 2008

73

Ketimpangan distribusi pendapatan pada Propinsi Jawa Timur dapat disebabkan oleh pertumbuhan dan keterbatasan yang dimiliki masingmasing daerah yang berbeda-beda serta pembangunan yang cenderung terpusat pada daerah yang sudah maju. Dalam kaitannya dengan hal ini, tentunya dibutuhkan informasi mengenai keadaan pemerataan pendapatan berdasarkan daerah. Ada beberapa ukuran ketimpangan distribusi pendapatan, salah satu indikator untuk menilai atau menggambarkan tingkat ketidakmerataan pembagian pendapatan penduduk suatu negara atau daerah adalah Indeks Theil (Theil Index) dan Indeks L (L-Index). Kedua metode tersebut pada dasarnya bertolak pada hal yang sama yaitu dapat dipecah-pecah (decomposable) menjadi komponen dalam grup dan komponen antar grup. Atas dasar pembandingan itulah dibuat ukuran-ukuran kemerataan/ketimpangan pendapatan. Indeks Theil bermanfaat untuk menggambarkan tingkat ketimpangan distribusi pendapatan yang hanya berdasarkan rataan pendapatan. Sedangkan Indeks L bermanfaat untuk menggambarkan pengaruh faktor demografi terhadap tingkat ketimpangan distribusi pendapatan. Dari hasil penelitian maka diketahui bahwa pada Propinsi Jawa Timur mempunyai tingkat ketimpangan distribusi pendapatan yang relatif menurun secara keseluruhan setelah krisis ekonomi. Penurunan ketimpangan distribusi pendapatan setelah krisis ekonomi tersebut bukan disebabkan karena pendapatan golongan masyarakat menengah ke bawah meningkat tetapi karena pendapatan masyarakat golongan menengah ke atas yang menurun secara drastis. 077 Pujiningsih, Sri; Sulastri. 2007. Sikap Akuntan Pendidikan terhadap Pelaporan Aktivitas Sosial Perusahaan

Kata-kata kunci: Akuntansi Sosial, Aktivitas Sosial, Regulasi, Norma Sosial

Pelaporan aktivitas sosial perusahaan bagi perusahaan publik di Indonesia masih bersifat sukarela. Akuntan pendidik cenderung menyetujui dalam menyikapi sebuah standar, misalkan standar mengenai peLaporan perubahan harga. Hal ini berbeda dengan akuntan internal yang cenderung tidak menyetujui. Tujuan dari penelitian ini adalah untuk menemukan bukti empiris apakah akuntan pendidik akan memberikan sikap yang sama terhadap pelaporan aktivitas sosial perusahaan. Penelitian ini nenggunakan pendekatan penelitian deskriptif. Populasi penelitian adalah akuntan pendidik FE-UM dan FlSE UNY. Teknik pengambilan sampel dengan menggunakan pendekatan convenience

74

Abstrak Hasil Penelitian

sampling. Adapun teknik pengumpulan data dengan menggunakan instrumen berupa angket.Teknik analisis data yang digunakan adalah analisis deskriptif. Berdasarkan hasil penelitian dapat disimpulkan bahwa responden berpendapat pelaporan aktivitas sosial perusahaan sangat penting dengan nilai 47.3%. Dalam hal ini Ikatan Akuntan Indonesia seharusnya mewajibkan perusahaan untuk melaporkan aktivitas sosialnya, skor dari item tersebut sebesar 60.6%. Untuk item aktivitas sosial perusahaan sebagian besar responden menganggap bahwa item yang sangat penting adalah meningkatakan kepuasan konsumen, dengan nilai sebesar 87.9%. Untuk dorongan regulasi dan pemerintah serta norma sosial masyarakat terhadap pelaporan akivitas sosial, responden berpendapat bahwa hanya sedikit dorongan tersebut. yakni sebesar 41.7%. Sedangkan pendapat responden yang menyatakan bahwa yang paling sedikit adalah aktivitas yang diwajibkan oleh hukum dan dispensasi bagi perusahaan atas aktivitas sosial sebesar 48.5% Berdasarkari hasil penelitian tersebut implikasi dari penelitian ini adalah perlu dukungan aktif dari Ikatan Akuntan Indonesia (IAI) bagi terwujudnya standar pelaporan akuntansi sosial. Bagi perusahaan, perlu untuk selalu meningkatkan kepuasan pelanggan, selain juga memberikan dukungan kepada lembaga sosial, dalam rangka meningkatkan kinerja sosial perusahaan. Bagi pemerintah perlu terus berupaya untuk mendorong diterapkannya akuntansi sosial dengan mewajibkan perusahaan publik untuk melaporkan aktivitas sosialnya demi kepentingan yang lebih luas tanpa mengabaikan kepentingari perusahaan. 078 Mentari, Sriyani; Widiastuti, Yuli. 2007. Analisis Faktor-faktor yang Mempengaruhi Underpricing pada Penawaran Perdana Saham Perusahaan di Pasar Modal Indonesia

Kata-kata kunci: underpricing, Indonesia underwriter, saham perusahaan, Pasar Modal

Penelitian ini bertujuan untuk menganalisis faktor-faktor yang berpengaruh terhadap underpricing. Underpricing terjadi ketika harga saham pada saat penawaran perdana (IPO) lebih rendah dari harga di pasar sekunder (Neil,dkk:1995). Berbagai faktor yang diduga berpengaruh terhadap underpricing yaitu: auditor, underwriter, metode akuntansi, ukuran perusahaan, financial leverage, profitabilitas, dan harga pasar. Sampel dalam penelitian ini adalah perusahaan yang melakukan IPO dari tahun

Edisi ke-27 Tahun 2008

75

1989-2004 yang mengalami underpricing. Total jumlah perusahaan yang memenuhi kriteria sampel adalah 46 perusahaan. Data diperoleh dari ICMD,dengan metode analisis yaitu analisis regresi berganda. Hasil penelitian menunjukkan bahwa lima variabel independen yaitu metode penyusutan aktiva tetap, metode penilaian persediaan, umur perusahaan, underwriter, dan financial leverage berpengaruh secara simultan dan signifikan terhadap underpricing. Sedangkan secara parsial hanya variabel metode penilaian persediaan, underwriter dan financial leverage yang berpengaruh terhada underpricing. 079 Subagyo; Susetyo, Yuli. 2007. Analisa Pengaruh Akuisisi terhadap Return, Abnormal Return, Trading Volume Activity (Studi pada Perusahaan Acquirer yang Listing di Bursa Efek Jakarta Tahun 2000--2004)

Kata-kata kunci: event study, akuisisi, abnormal return, trading volume activity, security return variability

Strategi perusahaan dalam melakukan akuisisi ditanggapi secara berbeda oleh investor. Ada beberapa penelitian yang menyimpulkan bahwa aksi perusahaan berupa akuisisi memiliki makna yang signifikan bahwa tindakan ini memberikan good news bagi investor sehingga direaksi investor dengan membeli sekuritas dengan harga yang tinggi dan menjual sekuritas dengan harga yang tinggi pula. Ada pula hasil penelitian yang menyimpulkan bahwa tindakan akuisisi merupakan suatu informasi yang buruk atau bad news sehingga menyebabkan return dan trading volume activity mengalami penurunan. Tujuan dari penelitian ini adalah untuk mengetahui apakah akuisisi menyebabkan pengaruh terhadap return, abnormal return, trading volume activity dan security return variability. Metode penelitian menggunakan event study dengan periode pengamatan selama 22 hari dengan 11 hari sebelum peristiwa dan 11 hari sesudah peristiwa. Uji dilakukan dengan 2 tahap uji, yaitu uji normalitas data selama periode pegamatan selanjutnya melakukan uji beda terhadap return, abnormal return, trading volume activity dan security return variability. Jika data normal maka uji beda dilakukan dengan Uji T: Paired Two Samples for Means tetapi jika data berdistribusi tidak normal maka uji beda dilakukan dengan Uji Wilcoxon. Hasil penelitian ini menunjukkan bahwa terdapat perbedaan antara return saham sebelum dan sesudah akuisisi pada periode pengamatan 11,

76

Abstrak Hasil Penelitian

10, 9, 8, 7, 6, 5 dan 4 hari sebelum dan sesudah akuisisi tetapi tidak ada perbedaan antara return saham sebelum dan sesudah akuisisi pada periode pengamatan 3, 2 dan 1 hari sebelum dan sesudah akuisisi. Terdapat perbedaan antara abnormal return saham sebelum dan sesudah akuisisi pada periode pengamatan 11, 10, 9, 8, 7, 6, 5 dan 4 hari sebelum dan sesudah akuisisi tetapi tidak ada perbedaan antara return saham sebelum dan sesudah akuisisi pada periode pengamatan 3, 2 dan 1 hari sebelum dan sesudah akuisisi. Terdapat perbedaan antara trading volume activity saham sebelum dan sesudah akuisisi pada periode pengamatan 11, 10, 9, 8, 7, 6, 5 dan 4 hari sebelum dan sesudah akuisisi tetapi tidak ada perbedaan antara return saham sebelum dan sesudah akuisisi pada periode pengamatan 3, 2 dan 1 hari sebelum dan sesudah akuisisi. Terdapat perbedaan antara security return variability saham sebelum dan sesudah akuisisi pada periode pengamatan 11, 10, 9, 8, 7, 6, 5 dan 4 hari sebelum dan sesudah akuisisi tetapi tidak ada perbedaan antara return saham sebelum dan sesudah akuisisi pada periode pengamatan 3, 2 dan 1 hari sebelum dan sesudah akuisisi. 080 Dewi, Titis Shinta; Nasikh. 2007. Upaya dan Proses Pemberdayaan Industri Kecil Kain Bordir Bangil Kabupaten Pasuruan

Kata-kata kunci: industri kecil, kain bordir, Pasuruan

Kain bordir Bangil tidak hanya dikenal di kabupaten Pasuruan, tapi juga dikenal didaerah lain bahkan sampai ke luar negeri. Walaupun badai krisis telah banyak mengakibatkan pengusaha menengah dan besar gulung tikar, namun industri kecil kain bordir Bangil tetap eksis. Hal ini membuktikan bahwa industri kecil tidak membebani pemerintah malah sebaliknya. Menyikapi kondisi ini memang layak industri kecil diberdayakan. Berkenaan dengan kondisi tersebut penelitian ini ingin mengkaji upaya pengrajin kain bordir Bangil dalam meningkatkan keberdayaan dirinya untuk memaksimalkan potensi usahanya. Berdasarkan hasil penelitian menunjukkan bahwa upaya pengrajin kain bordir Bangil dalam meningkatkan keberdayaan dirinya untuk memaksimalkan potensi usahanya mengandung nilai-nilai ekonomis meliputi peningkatan pendapatan, kesejahteraan keluarga dan kelangsungan hidup keluarga serta usahanya; sosial, memuat aspek peningkatan harkat dan martabat pengrajin industri kecil kain bordir Bangil serta status sosial yang semula sebagai pekerja menjadi pengrajin yang memiliki industri sendiri serta budaya, adanya keberanian, semangat juang, kerja keras,

Edisi ke-27 Tahun 2008

77

kreativitas, produktivitas dan kemauan untuk belajar meningkatkan desain tenunan. Proses pemberdayaan pengrajin kain bordir Bangil melalui tiga tahap yaitu: tahap inisial, tahap emansipatoris dan tahap partisipatoris. 081 Widiastuti, Yuli; Sulastri. 2007. Pengembangan Model Kemitraan Bertingkat Inti Berganda sebagai Sarana dalam Meningkatkan Produktivitas dan Pemasaran Industri Kecil Rumah Tangga (Studi pada Industri Kecil Rumah Tangga Emping Mlinjo di Desa Mejono, Kecamatan Plemahan, Kabupaten Kediri)

Kata-kata kunci: industri kecil, emping mlinjo, KUD

Penelitian ini bertujuan untuk mengetahui (1) Tipologi industri kecil emping mlinjo di desa Mejono; (2) Peranan pemerintah selama ini dalam upaya pembinaan industri kecil emping mlinjo di desa Mejono; dan (3) Bentuk pengembangan model kemitraan bertingkat inti berganda yang dapat diterapkan pada industri kecil emping mlinjo di desa Mejono. Penelitian ini dilaksanakan di Desa Mejono Kecamatan Plemahan Kabupaten Kediri dengan pertimbangan bahwa lokasi tersebut merupakan salah satu sentra industri kecil emping mlinjo yang ada di propinsi Jawa Timur. Selain itu, industri kecil emping mlinjo merupakan salah satu bidang yang diharapkan mampu menjadi komoditas unggulan daerah Kabupaten Kediri. Penelitian ini dilakukan dengan menggunakan metode kualitatif yaitu jenis penelitian yang tidak saja berambisi mengumpulkan data dari sisi kuantitasnya tetapi juga ingin lebih dalam mengungkapkan dan memahami fenomena di balik permasalahan yang berhasil dirumuskan. Berdasarkan survei awal yang dilakukan ditemukan bahwa populasi dalam penelitian ini adalah 16 orang pengepul yang menjadi plasma besar (PB) yang memiliki antara 25 sampai dengan 40 keluarga penuthuk sebagai plasma kecil (PK). Kondisi tersebut, mendorong peneliti untuk melakukan teknik stratified random sampling untuk menentukan sampel penelitian ini. Indriantoro dan Supomo (1999) menyebutkan bahwa teknik stratified random sampling dilakukan dengan cara terlebih dahulu mengklasifikasikan suatu populasi ke dalam sub-sub populasi berdasarkan karakteristik tertentudari elemen-elemen populasi. Sampel kemudian dipilih dari setiap sub populasi dengan metode acak sederhana. Bertolak dari tujuan penelitian dan untuk mendapatkan data yang diperlukan maka penelitian ini menggunakan beberapa metode pengumpulan data. Adapun metode yang digunakan meliputi :

78

Abstrak Hasil Penelitian

Berdasarkan hasil penelitian, maka dapat disimpulkan (1) Industri kecil emping mlinjo desa mejono menghsilkan emping mlinjo 7 macam ukuran emping yaitu emping kecik, biasa atau sen, benggol, siker, tanggung, besar dan sewidak tapi mlinjo tersebut masih dalam satu model. Emping mlinjo diproduksi oleh satu keluarga yang tenaga kerjanya adalah dari keluarga tersebut, biasanya terdiri dari 2-4 orang dan sebagian besar adalah wanita dan mereka disebut sebagai penutuk. Hubungan kerja antar penuthuk dan pengepul erat sekali seperti hubungan antara majikan dan karyawan didasari dengan hub kekeluargaan dan kepercayaan.Omzet penjualan stabil dihari biasa dan akan meningkat sekali pada hari-hari besar. Para penuthuk memperoleh modal dari para pengepul serta modal sendiri, selain itu untuk pengadaan bahan baku sangat tergantung dari panen biji mlinjo dan pasokan dari pengepul yang diperoleh dari pemasok yang berasa dari dalam maupun luar daerah. Disamping itu emping mlinjo dibuat secara tradisional dengan alat-alat tradisional. Untuk hal pemasaran biasanya penuthuk menyerahkan pada pengepul dan selanjutnya dipasarkan di lokal dan luar daerah; (2) Pemerintah pernah berperan dalam memajukan industri emping mlinjo di desa mejono dalam bentuk penuluhan dan pembinaaan dan bantuan pemberian alat-alat produksi seperti siker, kompor, wajan, besi, batu selain itu pemerintah juga mengadakan mlinjonisasi untuk menunjang pengadaan bahan baku dikabupaten Kediri dengan objek semua desa yang ada di kediri; dan (3) Pada dasarnya industri emping mlinjo yang ada didesa Mejono saling bekerjasama dimana kerjasama tersebut secara otomatis telah membentuk pada sistem kemitraan. Di samping terdapat permasalahan-permasalahan yang selalu melanda mereka terutama dari permodalan, sehingga masalah tersebut mempengaruhi produktivitas dan pemasaran produk yang didominasi oleh para pengepul yang tidak terorganisir. Untuk mengatasi masalah tersebut maka timbul adanya suatu kerjasama antara penuthuk dan pengepul dan pemasok dan kerjasama tersebut terjadi dalam bentuk mitra kerja yang saling menguntungkan kedua belah pihak, sehingga untuk lebih meningkatkan dan mengoptimalkan produktivitas dan pemasaran sangat dimungkinkan untuk menerapkan model kemitraan bertingkat inti berganada yang didukung dengan pelaku-pelaku tersebut. 082 Utami, Herlianti; Mentari, Sriyani. 2007. Pengaruh Kecerdasan Intelektual, Kecerdasan Emosional, dan Kecerdasan Spiritual terhadap Sikap Etis Mahasiswa Akuntansi (Studi pada Perguruan Tinggi di Kota Malang)

Edisi ke-27 Tahun 2008 Kata-kata kunci: kecerdasan intelektual, kecerdasan emosional, kecerdas-an spiritual, sikap etis

79

Penelitian ini ingin menguji pengaruh kecerdasan intelektual, kecerdasan emosional dan kecerdasan spiritual terhadap sikap etis mahasiswa akuntansi pada perguruan tinggi negeri di kota Malang. Responden penelitian ini adalah mahasiswa akuntansi yang telah menempuh mata kuliah auditing 1, khususnya materi etika profesi. Penelitian ini menggunakan metode survey langsung dengan 175 sampel. Analisis yang digunakan dalam penelitian ini adalah analisis regresi berganda untuk menguji pengaruh kecerdasan intelektual, kecerdasan emosional dan kecerdasan spiritual terhadap sikap etis mahasiswa akuntansi pada perguruan tinggi negeri di kota Malang. Hasil analisis menunjukkan bahwa kecerdasan intelektual dan kecerdasan spiritual berpengaruh signifikan terhadap sikap etis mahasiswa akuntansi, sedangkan kecerdasan emosional tidak berpengaruh signifikan terhadap sikap etis mahasiswa akuntansi pada perguruan tinggi negeri di kota Malang. 083 Jazimah; hanafi, Yusuf; Kholidah, Lilik Nur. 2007. Pengembangan Kecerdasan Spiritual Anak Balita Melalui Pemberdayaan Waktu Luang lbu-lbu Rumah Tangga oleh Komunitas Pengajian Muslimat Dinoyo Malang

Kata-kata kunci: kecerdasan spiritual anak balita, pemberdayaan waktu luang ibuibu rumah tangga

Peran mendidik anak merupakan tugas domestik perempuan sebagai ibu rumah tangga--di samping tugas-tugas domestik lainnya yang merupakan bukti kontribusi perempuan dalam pembangunan. Data di lapangan menunjukkan bahwa 80% aktivitas waktu luang ibu rumah tangga tidak dimanfaatkan secara efektif untuk mendidik moral dan mental anak balita mereka. lmplikasinya, pemanfaatan waktu luang sebagai waktu produktif untuk meningkatkan kualitas keluarga belum mencapai suatu pola ideal yang diharapkan. Kecenderungan aktivitas yang dilakukan oleh ibu-ibu rumah tangga dalam mendampingi balita mereka adalah aktivitas perawatan jasmani. Bahkan banyak aktivitas kontraproduktif yang dilakukan, antara lain: ngobrol, menonton acara-acara televisi yang kurang mendidik bersama anak tanpa memberikan pemahaman tentang nilai-nilai spiritual sehingga tanpa disadari anak belajar tentang konflik, mimpi materialistis, dan lain sebagainya.

80

Abstrak Hasil Penelitian

Mengingat kenyataan tersebut, maka kajian mengenai pemberdayaan ibu-ibu rumah tangga dalam memanfatkan waktu luang penting untuk dilakukan. Penelitian ini dimaksudkan untuk menyumbangkan pemikiran terhadap pengarusutamaan gender (gender mainstreaming), terutama untuk memberikan pemikiran yang mendasar mengenai pola pemanfaatan waktu luang ibu-ibu rumah tangga untuk mengembangkan kecerdasan spiritual anak-anak balita. Penelitian ini menggunakan pendekatan kualitatif yang berperspektif gender. Obyek penelitian adalah komunitas pengajian Ranting Muslimat Dinoyo Malang. Status responden bervariasi, yakni pengurus Ranting Muslimat Dinoyo, dai, dan anggota. Responden dipilih dan mereka yang betul-betul mengerti dan dapat menjawab pertanyaan, serta dapat memecahkan permasalahan yang muncul saat dilakukan pengambilan data. Berdasarkan temuan dalam penelitian ini, terkait dengan pemberdayaan ibu-ibu rumah tangga dapat disimpulkan hal-hal berikut: (1) motivasi ibu-ibu untuk mengikuti kegiatan pembinaan keagamaan cukup tinggi, (2) kesenjangan gender tidak tampak, karena adanya kesadaran akan pentingnya peningkatan kualitas keagamaan, (3) perempuan memiliki kontrol terhadap diri, (4) partisipasi perempuan tampak nyata, namun kekuatan personal tetap perlu ditingkatkan, (5) penyadaran perempuan relatif bersifat maju, dan (6) akses perempuan terhadap sumber daya diri itu setara, di mana perempuan memiliki hak untuk mengikuti kegiatan pembinaan di luar rumah serta pada level kesejahteraan sudah terlihat. Adapun terkait dengan pemanfaatan waktu luang ibu-ibu rumah tangga dalam mengajarkan nilai-nilai agama untuk mengembangkan kecerdasan spiritual balita, 90% dan mereka berpendapat perihal sangat penting-nya seorang perempuan sebagai ibu memperhatikan waktu luang. Adapun sisanya 10% hanya menjawab penting saja. Secara khusus ketika bersama putera-puterinya di waktu luang, ibu-ibu menyatakan memanfaatkannya untuk bermain sekaligus belajar (learning by doing). Tak jarang mereka juga membacakan kisah-kisah para nabi, orang saleh, dan cerita rakyat. Meski sebatas pengenalan, anak-anak juga mulai diajari membaca AI-Qur`an dan menghafal surat-surat pendek serta doa-doa keseharian (doa sebelum dan sesudah makan-minum, doa berangkat dan bangun tidur, doa-doa shalat). Adapun model-model pendidikan yang dibenikan adalah, antara lain: membiasakan shalat tepat pada waktunya, disiplin meletakkan barangbarang pada tempatnya masing-masing, mentradisikan selalu bersynkur kepada Allah atas segala limpahan rejeki dan karunianya, melatih saling menghargai, menghormati, dan tolong-menolong antar anggota keluarga,

Edisi ke-27 Tahun 2008

81

serta menumbuhkan rasa tanggungjawab dengan cara harus selalu bangun pagi untuk bersiap berangkat ke sekolah. Sedangkan nilai-nilai agama yang selalu diupayakan untuk ditanamkan adalah nilaii moral (akhlak), nilai akidah (keyakinan), nilai syariah (ibadah), dan norma hidup bermasyarakat. Terkait dengan teknik pengajaran pendidikan agama terhadap putera-puterinya, teridentifikasi ada tiga macam cara, yakni: melalui pengertian, melalui ajakan dengan penuh cinta-kasih, dan melalui uswah hasanah (teladan yang baik). Terkhusus untuk teknik yang terakhir, para ibu komunitas pengajian Ranting Muslimat Dinoyo menilai paling efektif, karena nalar anak balita belum cukup mampu menangkap pesan-pesan yang ditransformasikan secara verbal. Piaget mengemukakan bahwa cara berpikir anak-anak itu konkret. Anak akan mudah belajar tentang sesuatu apabila ada model atau contohnya. Contoh konkret bagii mereka adalah orang tuanya, yaitu individu yang setiap waktu dan hari berdekatan dengan mereka, baru setelah itu guru dan masyarakat sekitarnya. Pengembangan kecerdasan spiritual anak balita dapat ditempuh melaluii penanaman sikap-sikap positif, seperti menekankan pentingnya berbagi dengan sesama, saling menyayangi, dan berorientasi mencari solusi; komunikasi efektif dalam keluarga agar anak balita terangsang untuk mendengar, mengerti, dan berpikir, disiplin yang lebih mengutamakan self direction dan upaya memperbaiki diri latihan berempati pada masalah orang lain, dengan bersilaturahmi ke rumah kawannya yang sederhana; dan pembiasaan diri mengontrol ekspresi emosinya. lbu-ibu komunitas pengajian di Ranting Muslimat Dinoyo merasakan manfaat yang besar dan keikutsertaannya dalam organisasi sosial keagamaan ten,sebut untuk peningkatan kualifikasi diri dan pengayaan wawasan. Karena melaluii komunitas pengajian tersebut, mereka dapat memperdalam ilmu-ilmu agama sekaligus tidak ketinggalan informasi mengenai hal-hal terbaru yang terjadi di Tanah Air lewat tukar informasi dengan teman sejawat. 084 Sobri, Ahmad Yusuf; Sumarsono, R. Bambang. 2007. Internalisasi Gender dalam Pendidikan di MTsN Malang 2

Kata-kata kunci: internalisasi, gender, pendidikan

Model

Penelitian ini bertujuan untuk mendeskripsikan pandangan guru mengenai peran gender, dan mendeskripsikan kebijakan pendidikan yang diterapkan oleh personel MTsN Malang 2. Penelitian ini menggunakan pendekatan penelitian kualitatif dengan rancangan studi kasus. Temuan

82

Abstrak Hasil Penelitian

penelitian yang diperoleh, yaitu guru kelas di MTsN Malang 2 sudah memiliki sikap positif mengenai perlakuan adil dan setara pada siswa tanpa membedakan jenis kelaminnya. Sedangkan kebijakan responsif gender yang berkaitan dengan pembelajaran dan manajemen sekolah yaitu: keseimbangan perbandingan jumlah siswa antar jenis kelamin dalam kelas dan pembagian kelas berdasarkan jenis kelamin, mengikutsertakan guru (khususnya guru perempuan) dalam kegiatan pengembangan kompetensi guru yang berkaitan dengan pembelajaran setara gender, dan kebijakan seragam sekolah bagi semua siswa sesuai tuntutan agama. 085 Muslihati; Chusniyah, Tutus. 2007. Mekanisme Penguatan Hak-hak Reproduksi Perempuan Berbasis Pesantren di Wilayah Etnik Madura (Studi Kasus di Prabulinggih)

Kata-kata kunci: mekanisme, penguatan hak-hak reproduksi perempuan, pesantren

Salah satu tujuan pemberdayaan perempuan pedesaan adalah untuk menyadarkan mereka akan arti penting hak-hak reproduksi dan pemenuhannya. Perempuan pedesaan dengan minimnya pengetahuan dan budaya lokal yang masih cederung patriarkhi, berpotensi dapat menjadi korban tindak kekerasan. Salah satu lembaga strategis yang dapat melakukan upaya pemberdayaan perempuan di kalangan pedesaan adalah pesantren. Pesantren memiliki hubungan psikologis, sosial dan kultural yang erat dengan masyarakat desa. Dalam penelitian ini, dideskripsikan temuan mengenai upaya sebuah pesantren dalam memberdayakan perempuan pedesaan baik santri maupun masyarakat di luar pesantren khususnya mengenai pemenuhan-hak-hak reproduksi dan penanganan kasus tindak kekerasan pada perempuan. 086 Harmini, Sri; Winarni, Endang Setyo. 2007. Model Bermain sebagai Upaya Mensosialisasikan Kesetaraan Gender dan UU Kekerasan dalam Rumah Tangga (UUKDRT) pada Ibu-Ibu Pengurus PKK Tingkat Kecamatan Di Kota Malang

Kata-kata kunci: sosialisasi, kesetaraan gender, UUKDRT

Berdasarkan hasil isian angket dan wawancara dengan sebagian ibuibu pengurus PKK tingkat kecamatan di Kota Malang, disusunlah rencana tindakan dengan tujuan untuk mensosialisasikan Kesetaraan Gender dan Undang-Undang Kekerasan Dalam Rumah Tangga (UUKDRT).

Edisi ke-27 Tahun 2008

83

Pendekatan yang dilakukan dalam penelitian ini adalah penelitian kualitatif menggunakan rancangan penelitian tindakan dengan memberikan pengalaman melalui model bermain sebagai upaya mensosialisasikan Kesetaraan Gender dan UUKDRT pada ibu-ibu pengurus PKK tingkat kecamatan di Kota Malang. Untuk melaksanakan tindakan ini, disusunlah Rencana Tindakan I dan Tindakan II (2 siklus). Siklus I dan II diberikan pada ibu-ibu pengurus PKK tingkat kecamatan di Kota Malang yang memerlukan tambahan wawasan tentang Kesetaraan Gender dan UUKDRT berdasarkan hasil isian angket dan setelah mengikuti sosialisasi dari fasiIitator (sebelum bermain memakai beberan); dan (2) permainan simulasi dapat digunakan untuk mensosialisasikan Kesetaraan Gender dan UUKDRT pada ibu-ibu pengurus PKK tingkat kecamatan di Kota Malang. 087 Chusniyah, Tutut; Muslihati. 2007. Ideologi Gender dalam Novel Remaja (Analisis Novel `Zona Masa Depan' Karya Navisan Najia dan `Cinta Adisty' Karya Gisantia Bestari)

Kata-kata kunci: ideologi gender, novel remaja

Penelitian ini bertujuan meneliti isue yang mendasari pertanyaan tentang peran dan ideologi gender penulis remaja putri. Secara teoretik penulis novel remaja putri ini mengalami identifikasi gender yaitu terjadinya tekanan masyarakat untuk dijadikan diri pada peran gender maskulin dan feminin yang tradisional. Hasil penelitian menunjukkan bahwa penulis mencoba menyuarakan emansipasi peran gender ketika menggambarkan peran tokoh perempuan. Novel Zona Masa Depan menggambarkan peran gender kontemporer untuk tokoh perempuannya, sedang dalam novel Cinta Adisty tokoh perempuan digambarkan dalam peran gender egaliter. Namun ketika menggambarkan tokoh laki-laki, kedua penulis menampilkan peran gender tradisional dan ideologi feminin radikal pada tokoh novelnya. Dengan demikian, kedua penulis memberikan peran gender dan ideologi dominan yang berbeda ketika .menggambarkan tokoh laki-laki dan tokoh perempuan dalam novelnovelnya. Dari hasil penelitian ini, maka disarankan adanya dekonstruksi` sosial budaya perihal sikap dominan laki-laki terhadap perempuan dalam praktik kehidupan bermasyarakat.

84

Abstrak Hasil Penelitian

088 Kholidah, Lilik Nur; Kartini, Endang. 2007. Model Pengembangan Pendidikan Kesehatan Wanita dalam Mempersiapkan Generasi Muda Bangsa yang Berkualitas

Kata-kata kunci: model pengembangan pendidikan, pendidikan kesehatan

Kemajuan atau kemunduran suatu bangsa sangat ditentukan oleh kualitas surnber daya manusia calon penerus generasi saat ini. Pembangunan sumber daya manusia haruslah dimulai semenjak prakelahiran dalam kandungan maupun pasca kelahiran menyangkut proses dan upaya perawatannya, untuk menciptakan generasi penerus yang sehat dan berkualitas. Tujuan dari penelitian ini adalah untuk mendeskripsikan model pengembangan pendidikan kesehatan wanita dalam mempersiapkan generasi muda bangsa yang berkualitas yang dilakukan oleh Unit Kesehatan. Disamping itu untuk mendeskripsikan model pengembangan pendidikan kesehatan wanita dalam mempersiapkan generasi muda bangsa yang berkualitas yang dilakukan oleh ibu. Hasil penelitian ini diharapkan dapat memberikan masukan bagi pengembangan dan pemahaman ibu dalam peningkatan kesehatan bagi pendidikan generasi bangsa. Temuan penelitian ini akan bemanfaat bagi pusat studi wanita untuk menyusun langkah awal dan pedoman kegiatan dalam rangka pemberdayaan perempuan di bidang kesehatan. Disamping itu dapat pula menjadi input bagi pembuat kebijakan terutama dalam meletakkan kepentingan kesehatan perempuan sebagai agenda yang pantas dan tepat mendapat perhatian.Penelitian ini diharapkan dapat menjadi pijakan dasar untuk mengembangkan kegiatan riil yang ada dalam pola pengembangan kesehatan wanita khususnya ibu hamil. Penelitian ini bersifat studi kasus pada unit kesehatan UPTD Puskesmas sukun dan UPTD Puskesmas Mulyorejo kota Malang dipilihnya lokasi penelitian ini sebagai daerah penelitian dengan pertimbangan kedua unit kesehatan ini berkategori baik dalam merealisasikan program pelayanan kesehatan khususnya bagi ibu hamil. Penelitian ini menggunakan pendekatan kualitatif, teknik cuplikan yang digunakan bersifat purposive atau disebut criterion based selection, disini peneliti memilih responden yang dipandang mengetahui masalah yang akan diteliti dan dikaji. Informasi yang diperlukan berdasarkan karakteristik tertentu meliputi: (1) Petugas Kesehatan (2) ibu hamil Berdasarkan sumber data teknik pengumpulan data yang digunakan dalam penelitian ini adalah (1) wawancara mendalam, (2) observasi.

Edisi ke-27 Tahun 2008

85

Penelitian ini merupakan penelitian dengan pendekatan kualitatif, teknik yang digunakan bersifat purposif atau criterion basd selection, disini peneliti memilih responden yang dipandang mengetahui masalah yang akan diteliti dan dikaji. Informasi yang diperlukan berdasarkan karakteristik tertentu dalam penelitian ini meliputi: (1) petugas kesehatan pada unit terkait dan (2) ibu hamil yang memanfaatkan pelayanan kesehatan pada lokasi penelitian. Berdasarkan hasil penelitian ditemukan bahwa Secara lebih spesifik, dalam memberikan pelayanan kesehatan pada wanita Unit Pelaksana Teknis Kesehatan Daerah Puskesmas Mulyorejo dan Puskesmas Janti mengembangkan model pengembangan kesehatan dengan bentuk menyediakan buku kesehatan ibu dan anak. Buku kesehatan tersebut biasa disebut dengan BKIA. Buku kesehatan Ibu dan Anak ini memberikan penjelasan-penjelasan yang praktis dan lengkap tentang hal-hal yang harus diperhatikan ibu hamil sampai pada pasca melahirkan dan merawat balita. Model pengembangan kesehatan yang dilakukan ibu antara lain: Pertama, dari segi fisik, ibu memperhaatikan dan mengkonsumsi makanan yang bergizi, memeriksakan kehamilannya, Kedua, dan segi mental, ibu meciptakan ketenangan, membiasakan berpikir positif, bertingkah laku dan berakhlak yang baik. Ketiga, dari segi agama, ibu senantiasa mendekatkan diri pada Tuhan dengan senantiasa beribadah,berdo`a, mengikuti kegiatankegiatan keagamaan. Berdasarkan paparan dan pembahasan dapat diberikan beberapa saran, pertama, Kepada Dinas Kesehatan Kota Malang, meningkatkan sosialisasi program-program kesehatan yang dicanangkan dan menggerakkan gerakan sadar kesehatan; Kedua, UPT Puskesmas, meningkatkan pelayanan kepada masyarakat dengan lebih gencar mensosialisasikan gerakan sayang ibu, memberikan pelayanan kesehatan yang lebih baik dan lebih profesional; Ketiga, Pemuka Agama, memberikan pengetahuan-pengetahuan dalam perspektif keagamaan tentang pentingnya menjaga, memperhatikan kesehatan, menyiapkan serta mendidik generasii yang berkualitas. 089 Muhadjir, Imam dan Herawati, Ida Siti. 2007. Eksistensi Perempuan Pelukis dalam Perkembangan Seni Lukis mulai 1968 di Malang

Kata-kata kunci: aktivitas berkesenian, nilai estetis dan simbolik, perempuan pelukis Malang

Jumlah perempuan pelukis di kota Malang, yang mempunyai aktivitas berkesenian sangat sedikit jika dibandingkan dengan laki-laki pelukis,

86

Abstrak Hasil Penelitian

termasuk didalamnya ke-ajeg-an berkarya dan berpameran serta kegiatan seni. Belum diketahui bagaimana sebenarnya eksistensi perem-puan dalam perkembangan seni lukis di kota Malang. Penelitian ini bertujuan untuk mengidentifikasi, memahami dan menjelaskan: (1) perkembangan seni lukis di Malang sejak tahun 1968; (2) aktivitas berkesenian perempuan pelukis di Malang (profil dan peranannya); dan (3) nilai estetis dan simbolis yang terdapat pada karya lukis perempuan pelukis Malang meliputi tema, gagasan, teknik, wujud serta makna simbolik. Penelitian ini menggunakan rancangan kualitatif dengan sasaran perempuan pelukis Malang. Dengan berbagai pertimbangan subjek penelitian berjumlah 4 orang perempuan pelukis, dan 16 karya lukisnya. Prosedur pengumpulan data dengan pengamatan, wawancara dan dokumen, instrumen utama adalah peneliti sendiri dengan pedoman pengamatan dan wawancara, teknik pemeriksaan keabsahan data dengan triangulasi sumber dan diskusi rekan sejawat. Analisis data menggunakan analisis deskripsi secara menyeluruh dan menampilkan makna dari fokus penelitian. Hasil penelitian ini adalah (1) perkembangan seni lukis di kota Malang sejak 1968 berorientasi pada seni modern dan posmodern terutama pada aliran abstrak dan naturalis, dengan jumlah seniman lukis didominasi lakilaki, perkembangan para seniman lukis sangat dipengaruhi oleh adanya galeri yang bermunculan di kota Malang, diselenggarakannya pameran oleh seniman dari luar kota Malang serta perkembangan jurusan Seni Rupa FS Universitas Negeri Malang. Beberapa pelukis laki-laki sudah bertaraf nasional bahkan sudah ada yang go internasional; (2) aktivitas berkesenian bagi perempuan pelukis di Malang secara umum masih rendah, kegiatan melukis sekadar untuk mengisi waktu luang dan hobi dengan tidak mengutamakan profesionalisme, kegiatan pameran masih sedikit, hanya dua perempuan pelukis yang pernah mengikuti pameran nasional, keterlibatan dalam lembaga seni kota Malang tidak ada, keikutsertaan dalam forum diskusi/seminar seni masih rendah; dan (3) nilai estetis dan simbolis karya meliputi tema: alam, subjek lukisan: kehidupan manusia dan hewan, gaya lukisan: naturalistik, perwujudan: realistis, dengan menggunakan warna: monokromatik, garis: struktural, bentuk: nongeometris, tekstur: halus, keseimbangan: asimetri, emphasis: pada subjek yang ditonjolkan, format: lukisan horisontal. Saran yang diajukan dalam penelitian ini, (1) bagi perempuan pelukis: meningkatkan produktivitas dan kualitas karya lukis; (2) bagi pemerintah daerah: memfasilitasi aktivitas perempuan pelukis, memberi wadah dan kesempatan kepada perempuan untuk terlibat dalam lembaga kebijakan kesenian dan kegiatan seni; (3) bagi masyarakat: meningkatkan partisipasi

Edisi ke-27 Tahun 2008

87

perempuan untuk terlibat dalam wacana dan praktik berkesenian; dan (4) bagi peneliti: menindaklanjuti kajian serupa pada perempuan pelukis dengan lokasi yang berbeda. 090 Irawanto, Rudi; Sayekti, Pranti. 2007. Konstruksi Kelas, Feminitas, dan Seksualitas dalam Iklan Kosmetik-Kajian Konstruksi Kelas, Feminitas, dan Seksualitas Iklan Kosmetik di Media Cetak

Kata-kata kunci: konstruksi kelas, feminintas, seksualitas, ikian kosmetik

Iklan kosmetika di media cetak merupakan bentuk konstruksi dan atribut-atribut kewanitaan. Penelitian ini ingin mengkaji konstruksi kelas, feminitas dan seksualitas di media cetak. Penelitian ini menggunakan 5 jenis majalah sebagai sumber data penelitian, yaitu majalah Dewi, Femina, Gadis, Cita Cinta dan Lisa yang terbit sepanjang tahun 2006. Proses analisa konstruksi iklan menggunakan model analisa kontruktivisme dan dan Berger dan lackman. Hasil penelitian ini menunjukkan bahwa proses konstruksi kelas ditunjukkan dengan meletakkan iklan pada kelas sosial ekonomic status pada beberapa level. Positioning iklan dan segmentasi pasar yang diindikasikan dengan pesan verbal dan pesan visual merupakan salah penanda kelas-kelas sosial dan iklan yang bersangkutan. Konstruksi feminitas ditunjukkan dalam 2 tindakan umum, yaitu aktivitas feminin dan orientasi sikap feminin. Penampilan wanita dalam iklan kosmetik menunjukkan bahwa sikap sabar dan telaten yang menjadi citra dan wanita tidak dijumpai, wanita diposisikan sebagai sosok yang selalu mandiri dan meletakkan aktivitas bersolek sebagai awal dan penampilan dan citra diri. Penampilan yang baik menjadi prasyarat keberhasilan. Konstruksi seksualitas ditampilkan dalam visualisasi aktivitas fisik yang berkonotasi seksualitas. Pada visualisasi iklan kosmetik penampilan dir selalu bermuara pada sikap seksual. Wanita diposiskan sebagai pihak yang tengantung sepenuhnya pada penampilan dirinya. 091 Sunaryo, H.S.; Wijaya, Sri Umi Mintarti; Hanafi, Yusuf. 2007. Pandangan Kyai Pondok Pesantren di Kota Malang terhadap Keberpihakan Islam Atas Hak-hak Reproduksi Perempuan

Kata-kata kunci: pandangan kyai, hak-hak reproduksi perempuan

Banyak orang beranggapan bahwa hak reproduksi adalah urusan medis yang tidak ada hubungannya dengan persoalan agarna. Hasil

88

Abstrak Hasil Penelitian

penelitian Hasyim (1996) menunjukkan bahwa faktor agama merupakan salah satu faktor penghambat terwujudnya jaminan hak reproduksi perempuan. Sementara. mayoritas penduduk Indonesia adalah umat Islam yang masih memegang teguh budaya paternalistik dalam beragama yaitu sikap beragama yang lebih banyak mendengar dan meniru ucapan dan sikap para elit agama (kyai) dibanding menggunakan potensi rasionalitas yang dimiliki. Dipilihnya pesantren sebagai pusat kajian karena pesantren merupakan institusi pendidikan Islam tradisional Indonesia terbesar dan tertua yang memiliki pengaruh besar dalam rnewarnai kehidupan beragama masyarakat Indonesia. Selain itu, dua kitab utama, Qurratu al uyun dan Uqud al lujjain yang diajarkan di berbagai pesantren dinilal sarat dengan bias gender sehingga perlu diketahui peran keduanya terhadap keberpihakan hak-hak reproduksi perempuan. Penelitian ini bertujuan untuk mendeskripsikan pandangan kyai mengenai hak reproduksi perempuan. Desain penelitian yang digunakan adalah paradigma kualitatif dengan jenis deskriptif-interpretatip. Data dalam penelitian ini berupa: (1) catatan latar belakang, baik pendidikan maupun sosial budaya kyai, dan (2) pandangan kyai mengenai hubungan Islam dan hak reproduksi perempuan. Instrumen yang digunakan berupa angket dan wawancara. Angket digunakan untuk mengetahui latar belakang kyai sedangkan wawancara digunakan untuk mengetahui pandangan kyai terhadap hubungan Islam dan hak-hak reproduksi perempuan. Subjek dalam penelitian ini adalah para kyai pondok pesantren Kota Malang yang meliputi: PP. Miftahul Huda. PP. Al Fadloli, PP. Al Mubarok, PP.Sabilurosyad, dan Pesantren Mahasiswa Al Hikam. Hasil penelitian ini menunjukkan bahwa (1) berdasarkan latar belakang pendidikan dan sosial budayanya, pendidikan para kyai adalah SI dan S2. Selain sebagai pengasuh di pesantren beberapa kyai juga wirausaha dan menjadi dosen, (2) ada banyak hak yang harus diperoleh perempuan pada masa kehamilan, mulai dan pernikahan dan ketika hamil dengan kondisi wahnan ala wahnin perlu mendapat hak dan perhatian khusus dan suami baik secara materi maupun non materi, diperhatikan kesehatannya dan kecukupan gizinya, tidak diperbolehkan menceraikan istri pada saat istri hamil dan Islam sangat melarang adanya kekerasan dalam rumah tangga, dan (3) pada masa pasca melahirkan dibutuhkan perhatian khusus dari suami, cuti melahirkan perlu diberikan pada perempuan di saat melahirkan, Islam melarang suami untuk berhubungan badan saat istri nifas menunjukkan perhatian Iebih pada hak reproduksi perempuan, kewajiban mengasuh anak merupakan tanggung jawab kedua orang tua, bukan tanggung jawab istri semata.

Edisi ke-27 Tahun 2008

89

092 Zahro, Azizatus. 2007. Moralitas Tokoh Remaja Putri dalam Novel Teenlit

Kata-kata kunci: moral, tokoh remaja putri, novel teenlit

Sebagai cermin kehidupan sastra sarat akan nilai-nilai termasuk nilai moral. Karena itulah, sastra dapat digunakan sebagai sarana untuk menanamkan nilai-nilai moral kepada masyarakat atau pembaca. Sastra memiliki jangkauan yang luas karena dapat dibaca siapa saja, kapan saja, dan dimana saja. Penelitian yang menggunakan rancangan penelitian kualitatif ini dimaksudkan untuk mendapatkan deskripsi tipe moral tokoh remaja putri dalam tiga novel populer, yaitu Fairish, Kana di Negeri Kiwi, dan Aku vs Sepatu Hak Tinggi. Tipe moral religiosisme tercermin pada Fairish dalam novel Fairish. Fairish pada sebagian cerita digambarkan penulis sebagai tokoh yang bertipe hedonis, deontologis, dan eudemonis. Akan tetapi, secara umum, Fairish merupakan cerminan tokoh yang jalan hidupnya bermuara pada nilainilai agama yang ia anut. Tipe moral vitalis tercermin pada tokoh Metha yang selalu mengandalkan kekayaan dan kecantikannya untuk mencapai tujuannya. Tipe moral humanis tercermin pada tokoh Kana dalam novel Kana di Negeri Kiwi yang berasal dari keluarga multicultural. Tipe moral vitalis dan hedonis juga tercermin tokoh Sasha. Penulis menggambarkan Sasha sebagai remaja yang identik dengan kesenangan khas dunia remaja. 093 Dwi. Sulistyorini dan Ida Lestari. 2005. Pelecehan Seksual terhadap Tokoh Perempuan dalam Novel Perempuan di Titik Nol Karya Nawal El-saadawi

Kata-kata kunci: Pelecehan seksual, Tokoh perempuan, Novel

Dalam karya sastra sering kita temukan adanya kemiripan antara karya yang satu dengan yang lain, meskipun pengarangnya berbeda. Kemiripan itu dapat berupa gaya penulisan, tema cerita, setting, nama tokoh dan sebagainya. Salah satu cara untuk mengetahui kemiripan tersebut harus dilakukan perbandingan, yang lebih dikenal dengan sebutan sastra bandingan. Menurut Sapardi Djoko Damono, karya sastra dapat dibandingkan apabila memenuhi beberapa syarat, antara lain: karya sastra yang akan dibandingkan setidaknya mempunyai tiga perbedaan yang menyangkut perbedaan bahasa, wilayah dan politik. (2004:5). Novel

90

Abstrak Hasil Penelitian

perempuan di titik nol karya Nawal El-saadawi ini sudah diterjemahkan oleh Amir Sutaarga. Novel tersebut dibandingkan dengan novel the colour purple karya Alice Walkler. Kedua novel tersebut sama-sama mengangkat tema tentang pelecehan seksual. Pelecahan seksual itu dialami oleh tokoh utama perempuan pada kedua novel tersebut. Tujuan penelitian ini untuk mengetahui bentuk-bentuk pelecahan dalam novel perempuan Di Titik Nol karya Nawal El Saadawi dan The Colour Purple karya Alice Walker. Selain itu bertujuan untuk mengetahui dampak pelecehan seksual yang dialami oleh tokoh perempuan dalam kedua novel tersebut. Untuk merealisasikan tujuan tersebut,penelitian ini menggunakan rancangan kualitatif dan pendekatan feminisme. Peneliti mengidentifikasikan bentuk-bentuk pelecehan seksual maupun dampak yang dialami oleh kedua tokoh perempuan tersebut, kemudian mendiskripsikan data-data yang diperoleh. Hasil penelitian dideskripsikan sebagai berikut: bentuk pelecehan seksual yang dialami oleh tokoh perempuan dalam novel Perempuan Di Titik Nol ada lima tingkatan yaitu Gender Harassment, seduction behaviour, sexual bribery, sexual Coercion, dan sexual imposition. Sedangkan tokoh perempuan dalam novel The Colour Purple mengalami pelecahan seksual pada tingkatan gender harassmen dan sexual imposesion. Adapun dampak yang dialami oleh tokoh perempuan dalam novel Perempuan Di Titik Nol, antara lain: perasaan marah dan curiga pada orang lain, perasaan cemas, tertekan, takut, sakit hati, perasaan dendam, perasaan hampa, dan tidak dapat menikmati seks dengan wajar. Sedangkan dalam novel The Colour Purple, dampak yang dialami pada tokoh perempuan antara lain: putus asa, rendah diri, perasaan cemas dan takut, serta perasaan terluka. Dampak yang menimpa diri para tokoh perempuan tersebut menyebabkan mereka ingin membebaskan diri dari penindasan laki-laki. 094 Mahliatussikah, Hanik; Ridwan, Nur Anisah. 2007. Citra Wanita Arab dalam Novel Layla Majnun dan Citra Wanita Barat dalam Novel "Romeo Juliet": Tinjauan Kritik Sastra Feminis dan Hubungan Intertekstual

Kata-kata kunci: citra wanita, Layla Majnun, Romeo Juliet, intertekstual

Objek material yang berupa novel Layla Majnun (LM) dan novel Romeo Juliet (RJ) dipilih tidak terlepas dari keunggulannya, yaitu populer, menarik, dan problematis. Penelitian ini bertujuan untuk mengetahui peran, fungsi, dan kedudukan perempuan Arab dan Barat dalam novel Layla

Edisi ke-27 Tahun 2008

91

Majnûn dan novel Romeo Juliet; mengetahui wujud gambaran mental spiritual dan tingkah laku yang terekspresikan oleh perempuan Arab dan Barat dalam kedua karya; dan mengetahui hubungan intertekstual kedua karya. Penelitian ini diharapkan bermanfaat sebagai salah satu alternasi informasi bagi pembaca mengenai citra wanita Arab dan Barat dalam LM dan RJ dari sudut pandang kritik sastra feminis dan hubungan intertekstual. Penelitian ini menggunakan rancangan deskriptif kualitatif dengan sumber data utama teks novel yang diterbitkan oleh Navila Yogyakarta. Teknik pengumpulan datanya diawali dengan membaca dan mengkaji novel LM dan RJ; mengidentifikasi unit struktur yang menggambarkan peran, fungsi, dan kedudukan perempuan Arab dan Barat, dan wujud gambaran mental spiritual dan tingkah laku yang terekspresikan oleh perempuan Arab dan Barat dalam kedua karya; mengidentifikasi unit struktur yang menunjukkan adanya hubungan intertekstual antara kedua karya, dan merekam unit struktur yang akan menjawab 3 rumusan masalah. Teknik analisis data dilakukan dengan cara kodifikasi data, klasifikasi data, analisis data, dan menafsirkan data. Dominasi peran, fungsi dan kedudukan wanita Arab dan wanita Barat berada dalam lingkungan keluarga. Dalam kedua novel, fungsi dan kedudukan utama seorang perempuan adalah sebagai ibu, istri, dan anak. Sebagai ibu, seorang perempuan memiliki peran kodrati melahirkan, kemudian memberikan kasih sayang dan perhatian kepada anak. Sebagai istri, seorang perempuan berperan membantu suami dalam menyelesaikan masalah dengan memberikan nasehat dan saran yang menentramkan hati suami. Pemikiran istri dalam kedua novel dihargai oleh suami dan diterima. Seorang istri tidak hanya dibutuhkan dari aspek fisiknya yang cantik saja, tetapi perasaannya yang peka dan pemikirannya yang cemerlang juga dipertimbangkan. Adapun sebagai anak, seorang perempuan berhak mendapatkan pendidikan dan pergaulan yang sama dengan laki-laki. Hanya saja, dalam kedua novel, peran ayah menjadi dominan dalam menentukan jodoh sang anak. Pemaksaan itu pada akhirnya memicu sepasang kekasih untuk mengakhiri hidupnya. Pemaksaan terhadap perempuan itu dalam teori sastra feminis dianggap tidak manusiawi karena perempuan diperlakukan sebagai the others dari diri mereka. Dalam kedua novel, perempuan memiliki watak mental spiritual yang baik, yaitu setia, penuh perhatian terhadap orang yang dikasihi, taat kepada orang tua, memiliki rasa cinta; ingin mencintai dan dicintai, serta berani menanggung resiko demi mempertahankan cintanya. Perempuan dalam RJ dicitrakan lebih agresif daripada perempuan dalam kisah Layla Majnun. Perempuan Arab yang menjalin cinta kasih sebelum menikah dianggap aib

92

Abstrak Hasil Penelitian

oleh masyarakatnya. Sementara itu, bagi masyarakat Barat, menjalin cinta kasih sebelum pernikahan adalah hal yang sudah biasa dan bukan aib. Layla menyatakan cintanya kepada Majnun hanya lewat puisi. Adapun Juliet berani menyatakan cinta dan mempertanyakan kesungguhan Romeo terhadap dirinya. Hal ini menunjukkan bahwa dalam tradisi Barat, seorang gadis lebih berani dan terbuka untuk menyatakan perasaan cintanya kepada laki-laki dibanding dengan gadis dalam tradisi Timur. Terdapat hubungan intertekstual ide dalam kedua karya, baik berupa transformasi, modifikasi, maupun demitefikasi. Disebut transformasi karena kedua novel tersebut memiliki kesamaan ide, disebut modifikasi karena dalam kedua karya terdapat perubahan dan pengembangan ide, dan disebut demitefikasi karena dalam kedua karya terdapat pertentangan ide. Jika melihat keunggulan kisah Layla Majnun yang sudah melampaui dunia timur dan kemunculannya yang terlebih dahulu dibanding Romeo Juliet maka teks yang menjadi hipogram adalah kisah Layla Majnun. Bentuk transformasi yang telah di lakukan Shakespeare dalam romeo Juliet tidak hanya dari aspek judul, tema, dan tokoh saja, tetapi sudah menjangkau aspek alur cerita. Bentuk-bentuk transformasi, demitefikasi, dan modifikasi yang ada serta identitas kisah Romeo dan Juliet yang monumental menunjukkan bahwa Shakespeare memiliki kreativitas dalam menenun kalimat-demi kalimat sehingga kisah Romeo dan Juliet muncul sebagai karya cipta yang baru sebagai hasil serapan dari karya Layla Majnun. 095 Ida Lestari dan Dwi Sulistyorini. 2007. Relasi Gender dan Budaya Patriarki Dalam Kumpulan Cerpen "Lakon di Kota Kecil" Karya Ratna Indraswari Ibrahim

Kata-kata kunci: relasi gender, budaya patriarki, kumpulan cerpen

Berbicara tentang wanita tidak ada habisnya, karena dianggap menarik untuk diperbincangkan. Wanita itu sebagaimana pria yang memiliki persoalan-persoalan tersendiri, bahkan mungkin persoalan wanita lebih kompleks daripada pria. Peranan wanita sangat penting untuk memenuhi kebutuhan kehidupan sehari-hari. Ia harus memelihara keturunannya dengan berbagai aktivitas di dalam rumah tangganya. Tujuan penelitian ini untuk mengungkapkan relasi gender dan budaya patriarki yang tercermin dalam kumpulan cerpen Lakon di Kota Kecil karya Ratna Indraswari Ibrahim. Untuk merealisasikan tujuan itu penelitian ini menggunakan rancangan deskriptif. Dalam penelitian ini akan dideskripsikan tentang relasi gender dan budaya patriarki yang tercermin dalam kumpulan

Edisi ke-27 Tahun 2008

93

cerpen Lakon di Kota Kecil karya Ratna Indraswari Ibrahim. Untuk itu, pendekatan yang digunakan adalah pendekatan feminisme. Pendekatan tersebut digunakan untuk membantu membongkar aspek-aspek ketertindasan wanita oleh pria, serta perjuangan wanita untuk melawan ideologi patriarki. Data dalam penelitian ini berupa perian tentang relasi gender dan budaya patriarki yang diperoleh dari kumpulan cerpen Lakon di Kota Kecil karya Ratna Indraswari Ibrahim. Data ini diperoleh dengan cara menandai (coding) dan merekam unsur-unsur yang mengandung tentang relasi gender dan budaya patriarki. Sumber data dalam penelitian ini adalah kumpulan cerpen Lakon di Kota Kecil karya Ratna Indraswari Ibrahim. Hasil Penelitian ada empat (4) cerpen dari dua puluh (20) cerpen menggambarkan relasi gender yang menganggap perempuan sebagai makhluk superior, tiga (3) cerpen menggambarkan relasi gender yang menganggap perempuan sebagai makhluk sejajar dengan laki-laki, tigabelas cerpen (13) menggambarkan relasi gender yang menganggap perempuan sebagai makhluk inferior. Ideologi gender yang diterapkan oleh para tokoh dapat menguatkan budaya patriarki, dan menimbulkan ketidakadilan relasi gender. Budaya Patriarki adalah budaya yang menempatkan wanita sebagai inferior dan pria sebagai superior. Adapun cerpen-cerpen yang menunjukkan budaya patriarki adalah Lakon Di Kota Kecil, Busana Dayang Sumbi, Sepatu, Ini Buku Nana, Telponnya Sibi, Lebur, Rambutnya Juminten, Dewi Sata Gendari, Lampu, Orkestra, Ande-Ande Lumut, Ikatan, Boneka-Bonekaku. Tokoh laki-laki pada cerpen-cerpen tersebut menganggap perempuan sebagai makhluk yang patuh, lemah, taat, dan pasrah. Ia merasa berkuasa dalam segala aspek kehidupan dan menganggap dirinya sebagai sebagai makhluk superior. 096 Kamal, Musthofa. 2007. Kajian Sastra Muslim Kontemporer Indonesia Hubungan antara Lingkungan Sosial Pengarang ­ Karya ­ Pembaca

Kata-kata kunci: sastra, sosiologi pengarang

Perkembangan studi jender adalah hasil dari studi mendalam tentang budaya, Studi ini mempertanyakan tentang definisi tradisional tentang keluarga, peran masing-masing jender, serta reproduksi. Tujuan yang ingin dicapai dalam studi jender adalah untuk mengkaji ulang tentang hegemoni laki-laki serta membebaskan kaum perempuan dari prasangka-prasangka

94

Abstrak Hasil Penelitian

negatif yang selama ini menghalangi kaum perempuan dalam mendefinisikan dirinya. Untuk itu tim peneliti tertarik untuk mengkaji lebih jauh tentang suatu komunitas sastra religius yang cukup mapan di negeri ini, yaitu Forum Lingkar Pena (FLP) dan novel Dwilogi Sekar karya Muttaqwiyati. Tujuan yang ingin dicapai dalam penelitian ini adalah untuk: (1) mengetahui tentang organisasi FLP sebagai suatu komunitas kebudayaan, mempengaruhi persepsi pengarang terhadap kesetaraan jender; (2) mengetahui ide-ide tentang kesetaraan jender yang dituangkan dalam karya-karya anggota FLP; dan (3) mengetahui apakah persepsi pembaca tentang kesetaraan jender merupakan pengaruh dari karya-karya yang telah mereka baca. Sesuai dengan tujuan penelitian ini yakni mengetahui hubungan antara pengarang ­ karya sastra ­ pembaca, maka pendekatan yang digunakan adalah pendekatan sosiologi sastra.. Pendekatan yang digunakan dalam penelitian ini adalah pendekatan kualitatif. Dalam hal ini, peneliti bertindak sebagai instrumen kunci dalam pengumpulan data yang dilakukan dengan pengamatan secara mendalam melalui wawancara, dialog, dan mengikuti secara langsung beberapa kegiatan Forum Lingkar Pena di ranting Universitas Negeri Malang Hasil yang dicapai dalam penelitian ini adalah persepsi pengarang terhadap gender dalam karyanya, kehadirannya melainkan semata-mata dari kenyataan melihat lingkungan sosial yang ada di sekitarnya, kemudian direpresentasi melalui karya novel. Hanya saja, secara kebetulan tema yang diutarakan, dan perjalanan tokoh utamanya tepat bersinggungan dengan isu kesetaraan jender. Pembaca sebagai pengapresiasi karya--dalam hal ini adalah pembaca yang sudah dijadikan sampel--mendapatkan wawasan berkaitan dengan masalah gender. Jenis kelamin merupakan pensifatan atau pembagian dua jenis kelamin manusia yang ditentukan secara biologis yang melekat pada jenis kelamin tertentu, sedangkan gender adalah suatu sifat yang melekat pada jenis kelamin (laki-laki dan perempuan) kemudian dikonstruksi secara sosial maupun kultural, sifat-sifat tersebut memungkinkan untuk dipertukarkan sesuai dengan waktu, tempat, dan kelas sosial. Di samping itu, juga didapatkan nilai-nilai agama Islam: ajaran sholat, anjuran berbusana muslim, dan makna cinta sejati yang sangat kental dalam novel ini. 097 Utami, Tri Kapsari; Sa'dijah, Cholis. 2007. Kemampuan Kooperatif Siswa Perempuan dalam Belajar Matematika di SMP Kota Malang

Kata-kata kunci: kemampuan kooperatif, siswa perempuan

Edisi ke-27 Tahun 2008

95

Berdasarkan hasil diskusi dengan guru dalam forum MGMP ada dugaan bahwa kemampuan kooperatif siswa perempuan dalam pembelajaran matematika relatif masih kurang. Oleh karena itu, penelitian ini mengkaji kemampuan kooperatif siswa perempuan, dan membandingkannya dengan siswa laki-laki. Tujuan penelitian ini adalah mengkaji bagaimana kemampuan kooperatif siswa perempuan dalam pembelajaran Matematika dengan setting kooperatif tipe TPS dan apakah ada perbedaan kemampuan kooperatif siswa perempuan dan siswa laki-laki dalam pembelajaran Matematika tersebut. Penelitian ini merupakan penelitian deskriptip, yakni menerapkan pembelajaran Matematika dengan setting kooperatif tipe TPS untuk siswa SMP dan mengkaji kemampuan kooperatif siswa dalam belajar Matematika. Penelitian ini dilakukan pada siswa kelas VIlE di SMP Laboratorium Universitas Negeri Malang semester I tahun 2007/2008. Pelaksanaan penelitian ini melibatkan 2 dosen pendidikan matematika jurusan Matematika FMIPA Universitas Negeri Malang dan I guru Matematika SMP Lab UM dan 2 mahasiswa pendidikan Matematika FMIPA UM. Instrumen penelitian ini adalah Pedoman pengamatan keterlaksanaan pembelajaran Matematika kooperatif tipe TPS dan Pedoman Penilaian Diri dan Penilaian Teman tentang Kemampuan Kooperatif. Kemampuan kooperatif yang dimaksud adalah kemampuan berpartisipasi, kerjasama, dan sikap demokratis. Kesimpulan penelitian adalah kemampuan kooperatif siswa perempuan dalam pembelajaran Matematika dengan setting kooperatif tipe TPS adalah cukup baik. Dan tidak ada perbedaan kemampuan kooperatif siswa perempuan dan siswa laki-laki dalam pembelajaran Matematika dengan setting kooperatif tipe TPS. 098 Susilo, Singgih; Nawawi, Imam. 2007. Tenaga Kerja Industri Rumah Tangga di Kabupaten Malang (Suatu Kajian Gender)

Kata-kata kunci: industri rumah tangga; gender; perebutan lahan kerja

Pekerjaan industri rumah tangga adalah suatu bentuk kerja yang banyak disukai kaum wanita terutama yang sudah berkeluarga. Faktor penyebabnya adalah karena tidak memerlukan keahlian dan tingkat pendidikan formal yang tinggi, serta jam kerja yang luwes. Saat ini semakin banyak pekerja laki-laki yang memasuki industri rumah tangga.

96

Abstrak Hasil Penelitian

Penelitian ini mencoba memahami secara lebih dalam tentang berbagai hal yang berkaitan dengan masuknya tenaga kerja pria dan wanita pada kerja industri rumah tangga, khususnya konveksi kulit, dari persepektif gender. Penelitian dilakukan di Desa Jambeharjo Kecamatan Tajinan, Kabupaten Malang sebagai salah satu desa industri rumah tangga konveksi kulit yang memperkerjakan tenaga kerja wanita dan laki-laki. Populasi penelitian ini adalah wanita dan pria baik yang sudah maupun belum berkeluarga yang bekerja di bidang industri rumah tangga konveksi kulit. Sampel ditetapkan 50 responden dengan menggunakan teknik simple random sampling. Data dianalisis dengan penghitungan statistik non parametrik yakni deskriptif. Hasil penelitian ini menunjukkan beberapa karakteristik pekerja konveksi kulit yaitu bahwa tingkat pendidikan pekerja konveksi kulit tergolong tingkat pendidikan rendah, namun pekerja laki-laki mempunyai tingkat pendidikan lebih tinggi daripada pekerja wanita. Umur mereka tergolong berusia muda. Dari segi pendapatan keluarga, sebagian besar relatif tergolong rendah dan jenis pekerjaan ini sangat fluktuatif, ada saat musim sepi dan ada musim ramai. Musim sepi terjadi sebagian besar saat setelah hari raya Idul Fitri. Penelitian ini juga menunjukkan adanya ketimpangan gender pada bidang dan status pekerjaan, sehingga ada perbedaan pula dalam besarnya upah dan sistem pengupahan. Akan tetapi dalam hal jaminan tidak menunjukkan adanya perbedaan antara pekerja laki-laki dan wanita. Namun meskipun demikian pekerja wanita berpendapat bahwa keberadaan pekerja lakilaki pada konveksi kulit tidak merebut lahan pekerjaan wanita. 099 Priyatni, Endah Tri; Hamidah, Siti Cholisatul; Supeni, Ana Sri; Triantoro, Thomas. 2007. Peningkatan Kompetensi Menulis Paragraf Siswa Kelas VII SMPK Santa Maria 2 Malang dengan Teknik Scaffolding

Kata-kata kunci: menulis, paragraf, teknik scaffolding

Penelitian ini bertujuan untuk meningkatkan kompetensi siswa kelas VII SMPK Santa Maria 2 Malang dalam menulis paragraf dengan menerapkan teknik scaffolding, khususnya dalam hal peningkatan kompeten-si siswa dalam menulis paragraf yang memenuhi syarat: (1) keutuhan; (2) kelengkapan; (3) koherensi; dan (4) ketepatan penulisan ejaan dan tanda baca. Penelitian ini adalah penelitian tindakan kelas yang dilaksanakan di SMPK Santa Maria 2 Malang Kelas VII. Berdasarkan hasil pretes menulis

Edisi ke-27 Tahun 2008

97

paragraf, semua siswa memiliki kemampuan yang sama, maka dipilihlah satu kelas secara acak untuk dijadikan subjek penelitian, dan terpilihlah kelas VII-C. Jenis data yang dikumpulkan adalah data kuantitatif dan data kualitatif tentang keterampilan mahasiswa dalam menyusun paragraf. Data keterampilan menyusun paragraf diperoleh dengan menilai paragraf yang disusun siswa.Data tentang refleksi serta perubahan yang terjadi di kelas diambil dari jurnal. Dari tindakan yang telah dilakukan pada siklus I dan II dapat dideskripsikan pola penerapan teknik scaffolding dalam pembelajaran menulis paragraf adalah: diawali dengan penggunaan teknik pemodelan, pemberian latihan, pemberian umpan balik melalui kolaborasi, dan pemantapan pemahaman siswa. Pada siklus I perolehan nilai siswa jauh berada di bawah indikator penelitian ini. 52,94% siswa masih belum dapat menulis paragraf yang memenuhi syarat keutuhan dan kelengkapan paragraf. Namun, 78% siswa tidak mengalami kesulitan terkait dengan koherensi paragraf dan penulisan ejaan dan tanda baca. Ketidakutuhan paragraf yang disusun siswa disebabkan oleh belum mantapnya pemahaman siswa tentang ide pokok dan kriteria rumusan ide pokok yang baik. Sedangkan faktor miskin gagasanlah yang menyebabkan paragraf siswa belum memenuhi syarat kelengkapan. Penyebab utama dari munculnya kesulitan ini adalah dari teknik scaffolding yang diterapkan kurang disertai dengan latihan. Pada siklus II, kemampuan siswa dalam menulis paragraf yang memenuhi syarat keutuhan dan kelengkapan mengalami peningkatan yang signifikan. Dari 34 subjek penelitian ini, hanya ada 2 (5,88%)yang tidak tuntas, nilainya di bawah 75. Sedangkan 32 subjek penelitian (94,12%) telah tuntas, nilai di atas 75. Teknik scaffolding yang diperkuat dengan latihan bertahap telah berhasil meningkatkan kemampuan siswa dalam menulis paragraf. Keberhasilan ini juga didukung faktor guru yang profesional, ketelatenan, dan keseriusannya yang menyebabkan keberhasilan penerapan teknik scaffolding siklus II. Motivasi dan minat siswa yang sangat tinggi dalam mengikuti keseluruhan pembelajaran juga merupakan faktor penentu keberhasilan. Temuan penelitian menunjukkan bahwa manfaat nyata yang dapat dipetik dari penggunaan teknik scaffolding adalah siswa dapat menguasai pengetahuan dan keterampilan yang dilatihkan; menumbuhkan motivasi belajar siswa, dan meminimalkan rasa frustasi pada diri siswa. Mengingat manfaatnya yang demikian, disarankan kepada semua guru bahasa Indonesia untuk menggunakan teknik ini dalam pembelajaran bahasa Indonesia. Disarankan kepada pihak sekolah untuk memberikan kesempatan

98

Abstrak Hasil Penelitian

dan dukungan sarana dan prasarana agar penerapan teknik ini dapat mencapai hasil yang optimal. 100 Soewolo; Sribawanie, Ardaning; Mastini. 2007. Penerapan Siklus Belajar Sains Koperatif untuk Meningkatkan Kerja Ilmiah dan Prestasi Belajar Biologi Siswa Kelas VIII-A SMPN 4 Malang

Kata-kata kunci: siklus belajar sains kooperatif, kerja ilmiah, prestasi belajar

Dari diskusi bersama guru IPA Biologi kelas VIII dan guru kelas IX SMPN 4 Malang pada tanggal 10 Juni 2006, diperoleh data bahwa: KBK telah dilaksanakan di SMPN 4 Malang sejak tahun 2004. Berbagai model pembelajaran telah dilaksanakan terutama model pembelajaran kooperatif, sedangakan kerja ilmiah masih jarang dilakukan. Model pembelajaran kooperatif yang diterapkan belum dapat mengarahkan siswa untuk melakukan kerja ilmiah. Hal ini diperkuat dari data pengamatan pada Rencana Pelaksanaan Pembelajaran (RPP) kooperatif yang disusun guru masih belum mencerminkan hakekat belajar IPA, tidak ada tahapan kerja ilmiah. Pada contoh RPP tersebut meskipun kegiatannya praktikum (penyelidikan), namun nampak bahwa kegiatannya tidak diarahkan pada kerja ilmiah. Penelitian ini bertujuan meningkatkan kerja ilmiah dan prestasi belajar siswa kelas VIII A SMPN 4 Malang melalui penerapan siklus belajar sains kooperatif, bekerjasama dengan 2 orang guru Biologi SMPN 4 Malang. Siklus belajar sains kooperatif adalah siklus belajar 4E yang dilaksanakan dengan menerapkan elemen-elemen kooperatif. Subyek penelitian adalah siswa kelas VIIIA SMPN 4 Malang. Penelitian dilaksanakan dalam 2 siklus pada bulan Agustus s/d September 2007. Hasil penelitian menunjukkan, bahwa kerja ilmiah dan prestasi belajar siswa kelas VIIIA SMPN 4 Malang dapat meningkat melalui penerapan siklus belajar sains kooperatif dalam pembelajaran IPA Biology. Ada temuan di samping hasil penelitian tersebut: (1) dalam hal kerja ilmiah kesulitan siswa yang paling menonjol adalah merumuskan masalah dan merumuskan hipotesis dan (2) dalam hal kerja kooperatif, di dalam suatu kelompok siswa cenderung membentuk sub kelompok laki-laki dan sub kelompok perempuan yang masing-masing bekerja sendiri-sendiri, dan apabila dalam kelompok ada 1 siswa laki-laki diantara 3 atau 4 siswa perempuan atau sebaliknya, maka 1 siswa tersebut cenderung menyendiri. Dari hasil penelitian ini, peneliti menyampaikan saran: (1) dalam mengajarkan kerja ilmiah, disarankan guru menerapkan siklus belajar sains kooperatif; (2) sebelum menerapkan siklus belajar sains kooperatif, siswa

Edisi ke-27 Tahun 2008

99

perlu dilatih merumuskan masalah dan merumuskan hipotesis; dan (3) dalam menerapkan kerja kooperatif, disarankan guru selalu mengingatkan siswa untuk bekerjasama. 101 Nurhakiki, Rini. 2007. Peningkatan Penalaran dan Komunikasi dalam Menyelesaikan Soal Cerita mengenai Operasi Hitung Campuran di MJN Making I dengan PMR

Kata-kata kunci: PMR, penalaran dan komunmkasi, soal cerita

Dari hasil observasi terhadap siswa di kelas 3 SD, peneliti menjumpai kesalahan yang dilakukan siswa dalam meyelesaikan soal cerita. Adapun beberapa kesalahan yang dilakukan siswa pada waktu menyelesaikan soal cerita antara lain menuliskan kalimat matematika seperti contoh yang ada pada buku walaupun soalnya berbeda. Menuliskan kalimat matematika yang salah walaupun jika ditanyakan secara langsung mereka dapat menjelaskan dengan benar. Dari hasil observasi mi disusunlah suatu penelitian dengan tujuan untuk (1) mendiskripsikan langkah-langkah pembelajaran matematika melalui pendekatan pendidikan matematika realistik (PMR) untuk pokok bahasan menyelesaikan soal cerita mengenai operasi hitung campuran bagi siswa kelas 3 MIN Malang I; (2) meningkatkan kemampuan penalaran siswa kelas 3 MIN Malang I dalam menyelesaikan soal cerita yang berkaitan dengan hitung campuran menggunakan pendekatan PMR; dan (3) meningkatkan kemampuan komunikasi siswa kelas 3 MIN Malang I dalam menyelesaikan soal cerita yang berkaitan dengan hitung campuran menggunakan pendekatan PMR. Pendekatan yang dilakukan dalam penelitian ini adalah pendekatan kualitatif dengan menggunakan rancangan penelitian tindakan kelas, dengan memberikan pengalaman belajar yang mencerminkan pendidikan realistik matematik, yaitu memanfaatkan pengalaman nyata dalam kehidupan seharihari mereka. Dalam pembelajaran siswa terlibat dalam kegiatan kelompok maupun individual dengan diselingi permainan. Untuk melaksanakan tindakan ini disusun lah rencana tindakan melalui siklus-siklus pembelajaran. Siklus I siswa diberi soal-soal dengan menggunakan gambar berwarna. sedangkan sikius II siswa diberi soal-soal cerita tanpa menggunakan gambar walaupun untuk menyelesaikan siswa boleh menggambar atau menggunakan benda-benda. Siswa dapat mengejakan soal sesuai dengan cara mereka sendiri. Dari hasil penelitian ini dapat disimpulkan pembelajaran matematika

100 Abstrak Hasil Penelitian

untuk pokok bahasan Soal Cerita mengenai Operasi Hitung Campuran " dengan melalui pendekatan PMR dapat dilakukan (1 )memberikan soal cerita operasi hitung campuran yang disertai gambar dan tanpa gambar; (2) membentuk kelompok-kelompok yang terdiri 4 siswa, masing-masing anggota kelompok diberi LKS, siswa berdiskusi untuk menyelesaikan tugas tugas pada LKS; (3) Salah satu wakil kelompok mempresentasikan hasil diskusi kelompok lain menanggapi; dan (4).Pada akhir pembelajaran siswa menyelesaikan soal individual Ternyata dengan menggunakan PMR pemahaman siswa terhadap penalaran dan komunikasi menjadi lebih baik. 102 DS, Wasih; Bintartik, Lilik. 2007. Peningkatan Kualitas Kegiatan Penyelidikan dalam Pembelajaran Konsep Dasar Sains melalui Pendekatan PAKEM bagi Mahasiswa PGSD Blitar

Kata-kata kunci: PAKEM, PGSD, rancangan penyelidikan sains

Prodi D-II PGSD FIP Universitas Negeri Malang (UM) mengemban tugas mendidik calon-calon guru SD sebagai guru kelas. Sebagai calon guru kelas mahasiswa PGSD mempunyai kemampuan mengajar semua mata pelajaran di SD kecuali mata pelajaran Agama dan Olah Raga. Dari pengalaman dan hasil observasi pada perkuliahan awal semester untuk sajian matakuliah Konsep Dasar Sains diperoleh gambaran umum para mahasiswa pasif dan awam dengan kerja ilmiah dan metode ilmiah. Sementara itu dua unsur tersebut merupakan kegiatan ilmiah yang wajib diketahui dan dilakukan dalam proses belajar Sains. Pengetahuan dan kemampuan mahasiswa di bidang ini masih sangat kurang. Sedangkan di lain pihak sebagai guru SD dituntut untuk dapat menerapkan kerja ilmiah dan metode ilmiah dalam pembelajaran IPA SD. Oleh karena itu penelitian tindakan kelas ini dipilih untuk dicoba meningkatkan kemampuan mahasiswa yang masih sangat kurang terebut melalui penerapan pendekatan PAKEM dalam pembelajaran. Beberapa penelitian membuktikan kemampuan guru SD dalam mengembangkan kerja ilmiah dan metode ilmiah masih belum sesuai harapan. Mereka lebih cenderung mengajar IPA secara ekspositori. Karena itulah paradigma mengajar seperti itu perlu diminimalkan. Untuk mengatasi hal tersebut maka mahasiswa calon guru SD perlu secara langsung dilatih dan ditingkatkan kemampuan menggunakan metode ilmiah dalam belajar Sains. Terkait dengan masalah tersebut diharapkan pembelajaran Konsep Dasar Sains dengan menerapkan pendekatan PAKEM dapat meningkatkan

Edisi ke-27 Tahun 2008

101

kemampuan mahasiswa dalam kerja ilmiah (unsur penyelidikan dimensi perancangan). Penelitian dilaksanakan selama 8 bulan sejak persiapan bulan April 2006 sampai dengan November 2007. Penelitian tindakan ini menggunakan desain Penelitian Tindakan Kelas model Mc Taggart yang terdiri atas empat tahap, yaitu perencanaan, pelaksanaan dan observasi, refleksi.Subjek penelitian terdiri atas 41 mahasiswa yang tergabung dalam 12 kelompok. Hasil penelitian membuktikan bahwa pembelajaran dengan pendekatan PAKEM dapat meningkatkan kualitas kegiatan penyelidikan dimensi perancangan bagi mahasiswa PGSD Blitar. Kualitas peningkatan dinyatakan dengan persentase taraf penguasaan. Berdasarkan persentase itu secara kualitatif dapat diinformasikan kualitasnya. Pada tahap pra tindakan taraf penguasaan yang dicapai sebesar 44% (kategori sangat kurang), pada siklus I 64,20% (kategori cukup), pada siklus II 75% (kategori baik), dan pada siklus III 82,4% (kategori baik). 103 Parno; Sumarjono. 2007. Pengaruh Pembelajaran Menggunakan Peta Konsep dan Pemecahan Masalah terhadap Peningkatan Penguasaan Konsep Dasar Fisika Sekolah Mahasiswa

Kata-kata kunci: peta konsep, pemecahan masalah, konsep dasar fisika sekolah

Masih banyak mahasiswa belum menguasai materi fisika sekolah saat mereka melakukan praktik pengajaran mikro PPL I di kampus. Karenanya dalam Kurikulum Berbasis Kompetensi 2002 dimunculkan matakuliah Kapita Selekta Fisika Sekolah (KSFS) berbobot sks/js 2/4. Pembelajaran matakuliah KSFS pada semester ganjil 2004/2005 dan 2005/2006, yang menggunakan pendekatan pembelajaran kelompok, belum menghasilkan prestasi belajar mahasiswa yang memuaskan, yakni masing-masing hanya 43 dan 30. Berarti mahasiswa belum mampu belajar secara bermakna. Alternatif solusi untuk meningkatkan penguasaan konsep dasar fisika sekolah mahasiswa dalam matakuliah KSFS adalah mengganti pembelajarannya dengan model yang sesuai dengan karakter matakuliah KSFS, yaitu peta konsep dan pemecahan masalah. Mahasiswa yang memiliki penguasaan konsep dasar fisika sekolah diharapkan akan mempertebal rasa percaya dirinya saat melakukan PPL II di sekolah. Pembelajaran menggunakan peta konsep berguna untuk mendiagnosis miskonsepsi/kesalahan konsep mahasiswa. Semua miskonsepsi yang teridentifikasi melalui peta konsep mahasiswa, selanjutnya, akan diperbaiki melalui pembelajaran pemecahan masalah yang memiliki lima tahapan, yaitu

102 Abstrak Hasil Penelitian

memahami masalah, merencanakan penyelesaian masalah, melaksanakan rencana penyelesaian masalah, dan melihat kembali penyelesaian, serta membuat interpretasi hasil. Penelitian ini merupakan kuasi eksperimen dengan menggunakan rancangan randomized control group pre-test post-test design. Kelas eksperimen diberi perlakuan pembelajaran menggunakan peta konsep dan pemecahan masalah, sedangkan kelas kontrol menggunakan diskusi kelompok. Penelitian ini menggunakan materi mekanika I, mekanika II, gelombang, dan optik; dan sampel mahasiswa prodi Pendidikan Fisika FMIPA UM, yang pada semester gasal 2007/2008 sedang mengambil matakuliah KSFS. Pemilihan kelas eksperimen (24 mahasiswa) dan kelas kontrol (28 mahasiswa) ditetapkan secara acak. Sedangkan intrumen penelitian meliputi Tes Penguasaan Konsep Dasar Fisika Sekolah, Lembar Observasi pelaksanaan proses pembelajaran, Panduan Wawancara, dan Angket respon mahasiswa terhadap proses pembelajaran. Berikut disajikan hasil penelitian. (1) Deskripsi proses pembelajaran menggunakan peta konsep dan pemecahan masalah dalam matakuliah KSFS adalah tes awal, memaparkan tujuan matakuliah KSFS, kuliah singkat tentang pembelajaran menggunakan peta konsep dan pemecahan masalah, dan pembentukan kelompok peta konsep; pembelajaran menggunakan peta konsep untuk menemukan dan memperbaiki miskonsepsi dasar fisika sekolah; pembelajaran menggunakan pemecahan masalah untuk menyempurnakan perbaikan miskonsepsi tersebut; dan tes akhir dan penyebaran angket respon mahasiswa; (2) Pembelajaran menggunakan peta konsep dan pemecahan masalah berpengaruh terhadap peningkatan penguasaan konsep dasar fisika sekolah mahasiswa dalam matakuliah KSFS, yang ditandai oleh gain ternormalisasi rata-rata kelas eksperimen (0,46 kategori medium) lebih tinggi daripada kelas kontrol (0,15 kategori rendah); dan (3) Dalam pembelajaran matakuliah KSFS, mahasiswa kelas eksperimen, yang pembelajarannya menggunakan peta konsep dan pemecahan masalah, memberikan respon positip yang lebih besar daripada kelas kontrol, yang pembelajarannya hanya menggunakan diskusi kelompok. 104 Budiasih, Endang; Widarti, Hayuni Retno. 2007. Peningkatan Kualitas Pembelajaran Peserta Perkuliahan Analisis Instrumentasi melalui Pembuatan Peta Konsep Secara Kooperatif Model STAD

Kata-kata kunci: peta konsep, kooperatif, STAD

Edisi ke-27 Tahun 2008

103

Telah dilakukan penelitian yang berjudul Peningkatan Kualitas Pembelajaran Peserta Perkuliahan Analisis Instrumentasi Melalui Pembuatan Peta Konsep Secara Kooperatif Model STAD. Penelitian ini mempunyai tujuan untuk mengetahui peningkatan kualitas proses belajar mengajar ditinjau dari aspek kualitatif maupun kuantitatif. Penelitian ini dirancang sebagai penelitian tindakan kelas tiga siklus, dengan mengambil pokok bahasan Hukum Dasar Absorpsi, Aplikasi Analisis Secara Spektrofotometri, dan Spektrofotometri Infra Merah. Subyek penelitian adalah mahasiswa S1 Pendidikan Kimia yang sedang mengambil perkuliahan Analisis Instrumentasi di semester pendek 2006 ­ 2007, dengan jumlah mahasiswa sebanyak 36 orang. Instrumen penelitian terdiri dari instrumen pembelajaran, yaitu bahan ajar yang diwajibkan dan suplemen bahan ajar (hands out). Instrumen pengukuran dibedakan menjadi dua macam, yaitu instrumen pengukuran kualitatif (lembar observasi), serta instrumen pengukuran kuantitatif (peta konsep dan tes tertulis). Data kuantitatif dikelompokkan berdasa-kan rentangan skor tertentu, dan hasilnya disimpulkan berdasarkan patokan kemampuan yang berlaku di Universitas Negeri Malang. Berdasarkan analisis data, maka dari penelitian ini dapat disimpulkan bahwa penerapan pembelajaran melalui pembuatan peta konsep secara kooperatif model STAD pada matakuliah Praktikum Analisis Instrumentasi dapat meningkatkan kualitas proses belajar mengajar ditinjau dari aspek kualitatif maupun kuantitatif. Secara kualitatif peningkatan itu dapat diketahui dari kemampuan kooperatif mahasiswa dalam menyelesaikan tugas yang diberikan. Indikator peningkatan tersebut dapat dilihat dari aspek-aspek saling ketergantungan yang positif, interaksi langsung antar mahasiswa, pertanggungjawaban individu, dan keterampilan berinteraksi antar individu dan kelompok Secara kuantitatif dapat diketahui dari penilaian aspek kognitif, yaitu hasil peta konsep dan hasil ujian pada pokok bahasan Hukum Dasar Absorpsi, Aplikasi Analisis Secara Spektrofotometri, dan Spektrofotometri Infra Merah. Berdasarkan hasil analisis data, dapat disimpulkan telah terjadi peningkatan kemampuan mahasiswa siklus demi siklus. 105 Rahardjo, Boedi; Aripriharta. 2007. Analisis Besar Potensi Penghematan Energi pada Kasus Kelistrikan Rumah Tangga yang Menerapkan Sistem Manajemen Energi Model On-Demand

Kata-kata kunci: energi listrik, model on-demand, DSM, hemat energi

Pada kasus sistem kelistrikan rumah tangga, teknik demand-side management (DSM) untuk penghematan energi elektrik masih belum

104 Abstrak Hasil Penelitian

optimal. Model on-demand menawarkan solusi untuk optimalisasi penghematan energi dengan mengadopsi automation untuk pengendalian sistem kelistrikan rumah tangga. Untuk pemakaian peralatan listrik pada semua kelompok uji diperoleh data bahwa pemakaian energi listrik termasuk dalam kategori boros (tidak hemat), artinya telah terjadi pemakaian energi listrik berlebihan akibat pola konsumsi energi listrik yang kurang baik dan ketidak tepatan dalam pemilihan peralatan listrik yang digunakan. Besar energi listrik yang dipakai setiap bulan oleh pelanggan rumah tangga yang belum menerapkan model on-demand untuk kategori R-450 VA dan kategori R-900 VA pada pengujian terbatas terbilang boros karena melebihi level yang dianjurkan. Besar potensi energi listrik yang dapat di hemat oleh pelanngan rumah tangga yang menerapkan model on-demand untuk kategori R-450 VA dan R-900 VA berada pada level yang signifikan. Besar penghematan biaya beban energi listrik rata-rata perbulan yang dapat di capai dengan implementasi model on-demand pada manajemen energi listrik di rumah tangga untuk R-450 VA dan R-900 VA mencapai harga yang cukup signifikan. 106 Efendi, Mohammad. 2007. Model Pembinaan Perilaku Siswa Sekolah Menengah Pertama untuk Mencegah Tumbuh-kembangnya Kebiasaan Merokok

Kata-kata kunci: pembinaan perilaku, kebiasaan merokok, siswa SMP

Penelitian ini bertujuan mengungkap model pembinaan perilaku siswa SMP yang diagendakan pihak sekolah untuk mencegah tumbuh-kembangnya kebiasaan merokok. Untuk itu, penelitian ini dilakukan secara kualitatifnaturalistik, dengan subyek penelitian yang terdiri dari guru bidang studi dan siswa SMP yang ada di kabupaten dan kota Malang. Kesimpulan hasil penelitian bahwa model pembinaan perilaku siswa untuk pencegahan kebiasaan merokok yang diagendakan sekolah melalui berbagai momen belum terlaksana secara baik. Indikatornya: (1) adanya disparitas target yang hendak dicapai pada tataran operasional baik melalui program intra-kurikuler maupun ekstrakurikuler; (2) sumber bahan dan media pembinaan yang dijadikan rujukan tampaknya belum menyentuh esensi pembinaan itu sendiri; (3) strategi pembinaaan yang dielaborasi guru cenderung satu arah (ceramah), serta penerapan hukuman menjadi cara yang efektif untuk mencegah kebiasaan merokok; (4) evaluasi hasil pembinaan parameternya masih mengacu kepada frekuensi kemunculan perilaku merokok atau laporan tertulis yang dibuat siswa; (5) kondisi lingkungan (guru, orang tua,

Edisi ke-27 Tahun 2008

105

saudara, teman pergaulan) masih cukup menghambat program pencegahan perilaku merokok; dan (6) beberapa image atau persepsi yang salah menjadikan mereka ingin merokok. Untuk itu disarankan ada kebijakan pembatasan area peredaran rokok, pelarangan merokok di tempat umum (sekolah, rumah sakit, perkantoran atau tempat publik lainnya), membatasi penayangan iklan rokok secara bebas, dan sanksi yang berat bagi pelanggarnya. 107 Sulaiman, In`am. 2007. Pemahaman Makna Tindakan Wali Santri Memasukkan Anak ke Pondok Pesantren Salafiyah dalam Perspektif Fenomenologi

Kata-kata kunci: pesantren salafiyah, wali santri, tindakan sosial

Kemampuan pesantren salafiyah mempertahankan eksistensinya di tengah proses modernisasi dan globalisasi saat ini menimbulkan sikap yang berbeda di kalangan pakar pendidikan dan ilmu sosial. Ada yang bersikap pesimistis tapi ada pula yang optimistis. Di tengah kontroversi itu, terdapat sejumlah pesantren salafiyah di Jawa Timur yang mampu mempertahankan eksistensinya, bahkan diantaranya mampu berkembang. Secara teoritis, kemampuan pesantren salafiyah mempertahankan eksistensinya karena dukungan dan kepercayaan masyarakat pengguna (stakeholders) yang diaktualisasikan dalam tindakan memasukkan anak-anak mereka di lembaga tersebut. Dalam perspektif teori tindakan sosial, tindakan wali santri merupakan tindakan sosial, yaitu tindakan yang diarahkan oleh makna dan motif untuk mencapai suatu tujuan. Penelitian ini ingin menjawab permasalahan: (1) Bagaimanakah wali santri memaknai tindakan memasukkan anak-anak mereka di pesantren salafiyah?; (2) Nilai-nilai apkah yang mendasari tindakan wali santri?; dan (3) Bagaimanakah tipologi tindakan wali santri? Apakah tindakan mereka termasuk tipologi rasionalitas tradisional, emosional, rasional berorientasi nilai, atau rasional instrumental? Penelitian ini menggunakan desain penelitian kualitatif dalam perspektif fenomenologi. Pengumpulan data dilakukan dengan teknik pengamatan peranserta (participant observation), dan wawancara mendalam (indepth interview), dan dokomentasi. Sedangkan analisis data dilakukan melalui tahap: reduksi data, penyajian data, dan penerikan kesimpulan. Kesimpulan dari hasil penelitian ini adalah bahwa antara wali santri pesantren Sidogiri dan Pesantren lirboyo terdapat kesamaan alasan tindakan memasukkan anak di pesantren salafiyah, yaitu karena kepercayaan ter-

106 Abstrak Hasil Penelitian

hadap pendidikan pesantren, dan kesamaan tujuan untuk mencari ilmu yang bermanfaat, dan terbentuknya anak berakhlak mulia. Perbedaan alasan terletak pada keinginan untuk memperoleh barokah kiai, pembentuk kemandirian anak, dan harapan menjadi ahli agama. Nilai-nilai yang mendasari tindakan wali santri adalah nilai tradisional keluarga dan nilai keagamaan. Sedangkan tipologi tindakan mereka termasuk tindakan tradisional, dan tindakan berorientasi nilai. Berdasarkan hasil penelitian disarankan perlunya peningkatan kepercayaan masyarakat melalui penyempurnaan sarana dan prasarana pendidikan, dan perlunya penelitian lanjutan yang terfokus pada aspirasi wali santri tentang pendidikan yang hasilnya digunakan sebagai bahan updating program pesantrean. 108 Nurchasanah; Martutik. 2007. Tindak Tutur dan Kesantunan Tutur Berbahasa Indonesia Masyarakat Jawa di Lingkungan Kampus

Kata-kata kunci: tindak tutur dan kesantunan tutur

Berbahasa yang santun ibarat properti yang akan memberikan nilai tambah bagi penuturnya. Kesantunan diperlukan bagi masyarakat kampus mengingat mereka adalah calon pemimpin yang diharapkan menjadi teladan masyarakat lain. Karena itu diperlukan telaah khusus kondisi kesantunan berbahasa mereka, baik wujud, fungsi, strategi, situasi dan peristiwa yang melatarbelakangi, dan frekuensi nilai kesantunannya untuk menentukan pola tindak tutur dan kesantunan tutur mereka. 109 Widayati, Utami; Suharmanto; Furaidah. 2007. Pola Pemanfaatan SelfAccess Center (SAC) untuk Meningkatkan Kompetensi Bahasa Inggris Mahasiswa secara Mandiri

Kata-kata kunci: Self Access Center, kompetensi bahasa Inggris

Agar dapat bersaing di dunia yang selalu berubah dan bergerak maju ini (a fast-changing world), diperlukan pembelajar yang mandiri (autonomous learners). Kemandirian pembelajar (learner autonomy) mengarah pada pemberdayaan pembelajar untuk mampu menyelaraskan tujuan belajar, materi, dan teknik dengan situasi dan lingkungan yang cenderung berubah ini. Konsep kemandirian ini berasal dari pemikiran tentang pengembangan keterampilan belajar seumur hidup yang muncul pada tahun 1960an. Konsep

Edisi ke-27 Tahun 2008

107

kemandirian (autonomy) dalam pembelajaran bahasa secara historis dan teoritis berhubungan dengan pendekatan komunikatif. Pendekatan-pendekatan yang mendorong pembelajar untuk mengubah ketergantungan kepada guru ke arah kemandirian belajar diperikan dengan beragam istilah, seperti self-directed learning, self instruction, independent learning, dan self-access learning. Sejalan dengan maraknya pembahasan tentang perlunya menciptakan kemandirian pembe-lajar, berkembang pula wacana tentang perlunya fasilitas belajar mandiri. Self access merupakan istilah yang paling sering dipakai untuk penyelenggaraan pembelajaran yang mendorong munculnya aunonomy (kemandirian) melalui pendekatan berbasis sumber belajar (resource-based approach). SAC menyediakan materi-materi yang bervariasi, dari materi yang berupa bukubuku referensi dan buku-buku kerja atau kegiatan, sampai materi audio visual. Materi-materi dalam SAC disusun dengan tingkat kesulitan yang berjenjang sehingga pembelajar dapat menyesuaikan dengan tingkat kemampuan mereka. Selain itu, untuk materi yang berupa latihan-latihan, kunci jawaban juga telah disediakan. Dengan demikian, tersedia banyak kesempatan bagi pembelajar untuk memantau hasil belajarnya. Penelitian ini dimaksudkan untuk mengetahui pola pemanfaatan SAC oleh mahasiswa JSING, FS UM, dalam meningkatkan kompetensi Bahasa Inggris mereka secara mandiri. Dari hasil penelitian ini, diharapkan akan diperoleh gambaran tentang efektifitas pemanfaatan SAC sebagai sarana belajar mandiri. Dengan kata lain, tujuan penelitian ini adalah untuk mendeskripsikan pola pemanfaatan SAC oleh mahasiswa JSING, FS UM; untuk mencari pola pemanfaatan SAC yang dapat meningkatkan kompetensi Bahasa Inggris mahasiswa; dan untuk mencari pola pemanfaatan SAC yang mendorong perkembangan pembelajar bahasa yang otonom Penelitian ini menggunakan desain penelitian kualitatif, secara lebih sempit lagi deskriptif kualitatif. Data yang bersifat kuantitatif juga dikumpulkan untuk memberikan informasi tentang pola pemanfaatan SAC baik dilihat secara umum maupun dilihat berdasarkan tahun angkatan mahasiswa. Dengan kata lain, penelitian ini memanfaatkan data kuantitatif yang terkumpul untuk dapat mendeskripsikan secara kualitatif pola pemanfaatan SAC oleh mahasiswa JSING, FS UM. Subjek penelitian ini adalah 207 mahasiswa JSING, FS UM, baik dari Program Studi (Prodi) Pendidikan Bahasa Inggris maupun Prodi Bahasa dan Sastra Inggris, dari berbagai angkatan (2004, 2005, 2006, dan 2007). Instrumen pokok penelitian ini adalah peneliti sendiri. Instrumen lain untuk mendukung penelitian ini adalah angket pengumpul data dan lembar panduan wawancara.

108 Abstrak Hasil Penelitian

Penelitian ini menghasilkan temuan yang mengindikasikan kecenderungan bahwa semakin tua angkatan mahasiswa semakin banyak yang tidak menjadi anggota SAC. Hasil ini ternyata selaras juga dengan temuan tentang frekuensi kunjungan mahasiswa JSING ke SAC. Ada kecenderungan bahwa semakin tua angkatan mahasiswa, semakin banyak yang menyatakan tidak pernah berkunjung ke SAC, sedangkan untuk mahasiswa baru, tidak ada satupun yang menyatakan tidak pernah mengunjungi SAC. Selain itu, mahasiswa yang terlibat dalam penelitian ini memiliki persepsi tentang kompetensi Bahasa Inggris mereka dengan ratarata nilai 4,55 untuk keterampilan menyimak; 4,49 untuk keterampilan berbicara; 4,55 untuk keterampilan membaca; dan 4,49 untuk keterampilan menulis. Nilai rata-rata ini belumlah maksimal jika dibandingkan dengan tersedianya waktu untuk belajar. Mahasiswa bisa dikategorikan sebagai mahasiswa mandiri, yang diwujudkan dalam bentuk kemampuan melakukan refleksi terhadap kelemahan mereka, baik dalam aspek komponen bahasa (grammar, vocabulary, dan pronunciation), maupun aspek keterampilan bahasa (listening, speaking, reading, dan writing). Berdasarkan temuan tersebut, beberapa saran yang diajukan adalah sebagai berikut. Pertama, perlu ada kerjasama antara dosen pengampu matakuliah agar pemanfaatan SAC oleh mahasiswa dari berbagai angkatan menjadi bisa lebih maksimal. Kedua, SAC JSING perlu memperbanyak dan memutakhirkan koleksi materinya jika menginginkan pusat studi mandiri ini menjadi sarana belajar mandiri yang mampu memenuhi kebutuhan mahasiswanya dari berbagai angkatan dan dari berbagai tingkat kompetensi Bahasa Inggris. Ketiga, SAC JSING perlu menyediakan instrumen record keeping agar mahasiswa bisa memonitor hasil belajarnya dan untuk melihat kekuatan dan kelemahan dirinya. baik dalam aspek komponen bahasa (grammar, vocabulary, dan pronunciation), maupun aspek keterampilan bahasa (listening, speaking, reading, dan writing). Adanya instrumen seperti ini memungkinkan mahasiswa mampu mengevaluasi belajarnya sendiri sehingga secara bertanggungjawab akan mengatasi kekurangan yang dimiliki. Akhirnya, diperlukan penelitian lanjutan yang berupa penelitian pengembangan model-model pemanfaatan SAC yang efektif untuk meningkatkan kompetensi Bahasa Inggris dan kemandirian belajar mahasiswa. 110 Mistaram. 2007. Makna dan Fungsi Kembar Mayang Pesisiran Kajian Semiotik

Kata-kata kunci: makna, fungsi, kembar mayang pesisiran

Edisi ke-27 Tahun 2008

109

Kembar Mayang Pesisiran adalah salah satu properti dalam perkawinan adat yang vital. Keberadaannya mempunyai makna estetik, simbolik, dan fungsi tuntunan bagi masyarakat pendukungnya. Tesis ini merupakan penelitian kualitatif, dengan fokus penelitian pada produk Kembar Mayang Pesisiran, pembuat dan masyarakat pengguna di Dusun Sumber Desa Prigi Kabupaten Trenggalek . Latar Belakang pemilihan judul ini didasarkan atas kemenarikan dan keunikan produk Kembar Mayang Pesisiran, yang dibuat oleh orang-orang dengan persyaratan tertentu, dan tidak semua orang boleh membuatnya. Noses pembuatan dan penggunaannya memerlukan laku (persyaratan) yang hanya boleh dilakukan oleh Dukun Temu. Hal tersebut berbeda dengan produk Kembar Mayang di daerah perkotaan, yang bisa dibuat oleh siapa saja, yang tidak memerlukan laku(persyaratan) tertentu. Tujuan dari penelitian ini adalah sebagai berikut: (a) Mengidentifikasi dan mendiskripsikan bentuk dan struktur Kembar Mayang Pesisiran; (b) Mendiskripsikan dan menginterpretasikan makna estetik yang terkandung pada Kembar Mayang Pesisira, (c) Mengidentifikasi dan mendiskripsikan Fungsi yang ada pada Kembar Mayang Pesisiran; (d) Menginterpretasikan Makna Simbolik pada Kembar Mayang Pesisiran; dan (e) Mendiskripsikan sikap mistis masyarakat terhadap Kembar Mayang Pesisiran dalam penguatan dan pertahanan tradisi. Permasalahan dalam penelitian ini adalah sebagai berikut: (a) Bagaimana bentuk dan strktur Kembar Mayang Pesisiran; (b) Makna estetik apa saja yang terkandung didalamnya; (c) Fungsi apa saja Kembar Mayang Pesisiran dalam kehidupan masyarakat pendukungnya; (d) Makna simbolik apa saja yang terkandung didalamnya; dan (e) Bagaimana pemahaman mistis masyarakat terhadap Kembar Mayang Pesisiran. Untuk memecahkan permasalahan dalam penelitian ini digunakan keranga metodologi, dengan menggunakan strategi pertama yakni memilih subyek penelitian bersama setting dengan informasi berantai. Strategi kedua adalah mengkaitkan secara kualitatif antar bidang, yang tekanannya pada masyarakat pesisiran, dengan produknya yaitu Kembar Mayang Pesisiran, yang dikaji dengan kajian estetik, dan dianalisis secara semiotik. Proses pembuatan Kembar Mayang Pesisiran, di mulai dari menyiapkan bahan, upacara tebus Kembar Mayang Pesisiran, dan tatanan dalam penggunaan Kembar Mayang Pesisiran, merupakan perwujudan kebudayaan, dan masih dilakukan dan digunakan oleh masyarakat Dusun Sumber sampai kini Bentuk Kembar Mayang Pesisiran utama dapat dibagi menjadi tiga bagian, yaitu: (a) bagian bawah (dasar); (b) bagian tengah (badan); dan (c)

110 Abstrak Hasil Penelitian

bagian atas (mahkota). Pendampingnya disebut Watu Gunung, yang terdiri dari empat buah Kelapa Muda (cengkir), dua buah diberi loto-loto satu biji, dan yang dua buah diberi loto-loto tiga biji. Makna estetik pada Kembar Mayang Pesisiran, dapat dilihat pada komposisi dasar, dan komposisi tegak. Komposisi dasar terdiri dari lingkaran tengah dan empat garis menyilang, merupakan komposisi stabil, dan kokoh, yang dapat di interpretasikan sebagai kesiapan untuk membentuk keluarga baru yang dipersiapkan secara benar sesuai dengan pranata sosial di masyarakat dan lingkungannya. Komposisi tegak terdiri dari silinder dan segitiga sama kaki yang mengarah ke atas, yang dapat diinterpretasikan sebagai hubungan antara manusia dengan manusia di masyarakat, dan manusia dengan Tuhan dalam tatanan kehidupan keseharian dan tuntunan kehidupan kedepan, yaitu kehidupan setelah manusia meninggal dunia. Makna simbolik pada Kembar Mayang Pesisiran, dimulai darn penyiapan bahan, proses pembuatan, sistem tebusannya, dan penggunaannya. Hal-hal tersebut dapat dijabarkan sebagai berikut. Menyiapkan bahan bakunya, yang disiapkan oleh Keluarga dekat, yang dilaksanakan secara ihklas, dengan sepenuh hati, dan bertanggung jawab. Proses pembuatannya yang dilaksanakan oleh Tim pembuat Kembar Mayang Pesisiran, adalah bekerja yang sungguh-sungguh, dengan selalu memohon kepada Tuhan YME akan keselamatan, dijauhkan dari segala godaan, dan rintangan. Upacara tebus Kembar Mayang Pesisiran, adalah untuk menyiapkan kehidupan keluarga di masyarakat, dan kehidupan manusia dengan Tuhan YME, agar terpenuhi kehidupan lahir-batin, dunia akhirat yang merupakan nilai pendidikan masyarakat. Makna simbolik pada saat penggunaannya, adalah mempersatukan kedua mempelai dan keluarganya, yang berarti memekarkan manusia dalam sistem kekerabatan. Fungsi Kembar Mayang Pesisiran dalam kehidupan masyarakat, berfungsi sebagai pemersatu keluarga, dalam sistem kekerabatan. Berfungsi sebagai benteng budaya, dan juga sebagai pemekaran manusia dan syahnya dalam perkawinan adat. Fungsi dalam pendidikan masyarakat yang merupakan pendidikan nilai, yang berkaitan dengan nilai baik-buruk dalam kehidupan di masyarakat, nilai tuntunan kehidupan beragaman, yaitu hubungan manusia dengan manusia dan hubungan manusia dengan Tuhan YME. Pemahaman mistis masyarakat terhadap Kembar Mayang Pesisiran , bahwa benda tersebut sebagai benda sakral yang harus ada dalam upacara perkawinan secara adat, dan sebagai penanda syahnya perkawinan yang dilakukan di Dusun Sumber.

Edisi ke-27 Tahun 2008

111

111 Hadi, Nur; Poerwaningsih, Siti. 2007. Model Perilaku Adat Efektif Petani Sayur Tengger, di Desa Ngadas Kabupaten Malang, pada Lahan Miring di Kantong Taman Nasional BTS

Kata-kata kunci: perilaku adat efektif, petani sayur, lahan miring, Tengger

Keadaan masing-masing petani dengan perbedaan status di kalangan mereka kemungkinan menimbulkan perbedaan persepsi dan perlakuan terhadap alam. Berkaitan dengan itu terdapat keperluan untuk mengetahui bagaimana sesungguhnya hubungan antara adat istiadat sebagai nilai tertinggi dalam orientasi sosial seseorang mempengaruhi perilaku dalam memenuhi hajat hidupnya yang paling mendasar. Disamping itu pola-pola hubungan yang ada pada petani sayur di Tengger dengan bingkai adat istiadat Tengger terhadap pengolahan lahan miring di Taman Nasional BTS. Pola-pola kearifan budaya lokal dalam memanfaatkan lahan miring yang terbatas inilah yang ingin didapat sebagai bentuk model perilaku efektif. Bagaimana nilai-nilai budaya mempengaruhi laju dan pemanfaatan IPTEKS di bidang pertanian menjadi kajian utama. Empat masalah yang pokok yang hendak dijawab dalam penelitian ini. Pertama, bagaimana sesungguhnya perilaku petani sayur Tengger pada lahan miring? Kedua, apa alasan yang mendorong para petani membudidayakan sayur di lahan miring pada kantong Taman Nasional BTS? Ketiga, apakah perilaku petani sayur tersebut didasari oleh sebuah kesadaran akan nilai-nilai adat budaya Tengger? Keempat, apakah status sosial mereka di tengah masyarakat desa memberikan pengaruh bagi keragaman perilaku sebagai petani pada lahan miring? Pendekatan yang digunakan dalam penelitian ini adlah kualitatif. Tujuan utama penelitian ini adalah menentukan model perilsku efektif petani sayur pada lahan miring di kantong Taman Nasional BTS yang dibingkai dengan nilai-nilai adat budaya Tengger. Model perilaku demikian merupakan etinitas yang kompleks yang perlu dipahami secara mendalam dan holistik. Oleh karenanya pilihan rancangan penelitian dengan pendekatan kualitatif dilakukan agar didapat model perilaku yang benar dengan berbasis pada adat budaya masyarakat yang bersangkutan. Di samping itu karena terkait dengan masalah adat budaya masyarakat sesuatu suku, juga dilakukan penggabungan dengan model pendekatan etnografi. Penelitian ini dilakukan di Desa Ngadas Tengger, yang menempati areal pada kantong Taman Nasional Bromo-Tengger-Semaru (BTS). Subyek penelitiannya adalah masyarakat petani sayur pada lahan miring yang berdomisili di Desa Ngadas, terutama Kepala Desa (Pak Kartono) dan

112 Abstrak Hasil Penelitian

Dukun (Mbah Ngatrulin) serta Wong Sepuh dan bapak Legen (Pembantu Dukun) yang dipilih untuk kepentingan tujuan penelitian/purposive sampling. Sedangkan yang menjadi obyek penelitian adalah keberadaan kantong Taman Nasional BTS tempat para petani sayur membudidayakan lahan miring, yang meliputi kondisi fisik tanah, tumbuhan/tanaman, kondisi curah hujan dan kelerengan tanah. Guna dapat mengumpulkan data-data tersebut digunakan teknikobservasi, wawancara mendalam secara partisipatif hingga titik jenuh, dan dokumentasi serta teknik Life History. Tema adat budaya sesuatu suku akan didalami dengan pendekatan etnografi dengan alur maju bertahap model Spradley, yang meliputi: penetapan subyek penelitian/informan, wawancara, catatan etnografis, pertanyaan deskriptif, analisis/wawancara, analisis domain, pertanyaan kontras, analisis komponen, dan temuan tema budaya. Data dianalisis dengan metode etnografis model Spradley (1977), dan juga model analisis interaktif yang dikembangkan oleh Miles dan Huberman (1992), yang meliputi tiga tahap, yaitu: reduksi data, penyajian data, menarik kesimpulan. Serta untuk menjamin keabsahan data dilakukan dengan beberapa kriteria: derajat kepercayaan, keteralihan, ketergantungan dan kepastian. Hasil penelitian menunjukkan bahwa: Para petani sayur Tengger yang secara ekologis memiliki lahan pertanian berupa ladang (tegalan) pada lahan miring ternyata memiliki kiat tertentu untuk dapat membudidayakan hasil pertaniannya dengan menggunakan adaptasi ekologis tertentu seperti menggunakan galengan atau kalenan untuk mengalirkan air hujan ke dalam bedengan yang dibuat berliku. Keadaan ekologis terbatas, mampu direspons secara cerdas, dengan melakukan: (1) Lahan-lahan pertanian yang ada telah dibagi ke dalam beberapa petak kecil antara 300-600 M2 untuk tiap petak, dengan masing-masing petak yang menjadi hak kepemilikan keluarga yang bersangkutan terletak saling berjauhan. Keadaan itu terjadi sebagai akibat dari: model pewarisan lahan pertanian kepada anak-anak mereka dan perolehan lahan yang didapat seseorang beserta pemaduan lahan yang terjadi sebagai akibat perkawinan antar keluarga Tengger dan (2) letak dari petak-petak lahan yang tersebar tersebut menguntungkan dan merupakan bentuk adaptasi ekologis terhadap kemungkinan rusaknya sebagian kawasan yang mungkin terjadi karena longsor atau gagal panen, maka pada kawasan lainnya masih dapat diselamatkan. Alasan Membudidayakan Di Lahan Miring Taman Nasional BTS: sudut kemiringan lahan pertanian di desa Ngadas terlihat amat curam, pemadangan seperti lukisan alam yang indah, sekaligus ngeri, betapa tidak bahwa jalan menuju ke masing-masing lahan amat curam, juga permukaan lahan

Edisi ke-27 Tahun 2008

113

yang diolah terlihat membentang dari atas ke bawah dengan tajam. Namun model pembudidayaan lahan kering tersebut nampak cerdas. Tidak ada waktu yang khusus, seperti bulan yang khusus untuk sayur-sayuran yang dihasilkan. Masing-masing petak lahan yang diolah ditanami dengan aneka jenis sayuran, dengan masa atau daur tanam dan panen yang tidak sama, sehingga boleh dikatakan bahwa pada setiap waktu dapat terjadi tanam dan panen yang berturut. Kondisi ini secara ekonomis sangat membantu mereka. Dunia agraris yang selamanya selalu dibawah tekanan dan terkalahkan oleh dunia industri sebagai akibat bahwa masalah-masalah pertanian sangat tergantung pada musim, dan cuaca, tidak dikenal adanya panen raya , serta menguntungkan dari persediaan dan pengendalian harga sayuran. Kaitan Adat Budaya Tengger dan Perilaku Bertani sebagai masyarakat adat yang secara goegrafis terisolir, berkembang model konservatisme budaya Tengger. Sosialisasi budaya dilakukan untuk timbul rasa cinta terhadap alam. Pola hidup keluarga Inti. Menerima pengaruh pembangunan dan moderenisasi secara intensif beserta nilai-nilai dan gaya hidup yang menyertainya dalam bentuk kepemilikan benda-benda yang berhubungan dengan dunia pertanian seperti alat-alat transportasi dan pembangunan rumah tempat tinggal mereka yang mewah. Namun jati diri sebagai warga masyarakat adat masih bertahan. Hukum adat Tengger tidak membolehkan jual beli lahan di Tengger kepada orang-orang dari luar desa Tengger. Keadaan ini menguntungkan secara ekonomis, sebab pengolahan lahan miring mutlak dikerjakan secara mandiri, tanpa adanya campur tangan dari pedagang perantara dan makelar. Pola hubungan antara masalah pewarisan adat budaya yang kuat dan pola penggarapan lahan yang tegas dilahan miring yang terbatas adalah bentuk kearifan lokal yang dijumpai di lokasi penelitian. Kearifan lokal itu perlu didesiminasikan pada komunitas lain sejenis. Status sosil masyarakat Tengger amat homogen. Sebagai pemilik dan penggarap tanah, timbul kesetaraan dalam status sosial petani, dan ternyata memiliki hubungan kuat dengan perilaku sebagai petani sayur di lahan miring. Walau di Tengger terdapat status sosial yang pada jabatan dukun dan kepala desa, namun tidak terjadi hubungan Patron-Klien. Hal itu terjadi karena model kepemilikan tanah di Tengger yang memberikan hak-hak milik yang utuh kepada para pemiliknya, sehingga terdapat masalah pengolaha lahan pertanian masyarakat bergerak secara individual untuk menjadi petani yang ulet dan berhasil untuk kepentingan keluarganya masing-masing, tanpa terikat pada hubungan ketetanggaan dan hubungan dengan para pemimpin Tengger. Individualisme yang terjadi dalam pengolahan lahan miring tidaklah mengurangi sifat komunalitasnya sebagai warga masyarakat adat. Sifat

114 Abstrak Hasil Penelitian

komunalitas terlihat pada moment-moment tertentu seperti menjalankan ritus, atau mendirikan rumah, yang membutuhkan sifat kegotong royongan seluruh warga masyarakat. 112 Suprapta, Blasius; Wedhanto, Sonny. 2007. Penggunaan Citra Landsad 7 ETM Untuk Rekonstruksi Keraton Masa Hindhu-Budha (Studi Kasus Rekontruksi Keraton Singhasari Abad XIII-XIV dengan Citra Landsad ­ 7 ETM)

Kata-kata kunci: citra landsad­7ETM, tata ruang keraton Singhasari, desa Singosari

Penginderaan jauh merupakan ilmu dan seni dalam ekstraksi informasi mengenai suatu obyek, wilayah, atau fenomena termasuk obyek arkeologi, melalui analisis data yang diperoleh tanpa melalui kontak langsung dengan obyek, wilayah atau fenomena yang dikaji (Lillesand, Thomas M, dkk, 2004: 1-3). Metode ini digunakan apabila peneliti harus mengamati areal yang sangat luas seperti sruktur geologi suatu kawasan, pemantauan lahan hutan, evaluasi daerah genangan banjir, dan termasuk penelitian situs pemukiman dalam arkeologi. Penggunaan teknik penginderaan jauh untuk mengamati kawasan yang luas terbukti dapat mengurangi biaya penelitian dalam jumlah besar dan mempercepat pekerjaan, sebab dalam satu kali penyiaman, setelit mampu merekam luasan 185x185 km2 (Lillesand, Thomas M, dkk, 2004:1314). Sehubungan dengan hal ini, untuk mengamati daerah yang luas seperti halnya situs pemukiman dalam arkeologi tidak perlu lagi melakukan penelitian ekskavasi secara menyeluruh (total ekskavasi), sehingga biaya pelaksanaan penelitian menjadi lebih murah. Secara teoritis teknik penginderaan jauh dapat digunakan untuk penyelidikan situs-situs pemukiman arkeologi (Lillesand, Thomas M, dkk, 2004: 286-287). Kendati demikian cara ini, khususnya penggunaan citra satelit belum pernah dilakukan di Indonesia. Salah satu situs arkeologi yang mencakup kawasan luas adalah situs bekas ibu kota Kerajaan Singhasari yang keletakan situsnya, diperkirakan di daerah Pegatan, Singosari, Malang, Jawa Timur. Berdasarkan data kitab kakawin Nagakertagama, pada tahun saka rasa gunung bulan atau 1176C (1254M) Kerajaan Singhasari di bawah pemerintahan raja Kertanegara putra mahkota Wisnuwardhana, ibu kota kerajaan dipindahkan dari Kotaraja ke Singhasari (Slametmulyana, 1979: 294-295) yakni daerah Singosari sekarang yang sekarang masuk daerah Kecamatan Singasari, Kabupaten malang, Jawa Timur. Karena perubahan jaman, saat ini Singhasari hanya dikenal sebagai sebuah wilayah kecamatan kecil di pinggiran Kota Malang, Propinsi Jawa

Edisi ke-27 Tahun 2008

115

Timur. Sebagian besar daerahnya berupa areal persawahan yang subur. Namun bila melihat perkembangan rumah pemukiman yang begitu cepat sepertim sekarang ini, maka, cepat atau lambat lahan-lahan di kecamatan Singosari tersebut akan dijual oleh penduduk. Beralihnya tata guna lahan dari sawah menjadi areal permukiman membawa implikasi hilangnya tanda keberadaan suatu situs kuno. Gejala pelenyapan situs arkeologi di daerah Singosari sudah mulai nampak. Hal ini salah satunya antara lain disebabkan adanya perkembangan kota Malang sebagai kota kedua terbesar di Jawa Timur. Para pengamat perkotaan di malang meramalkan tak sampai 10 tahun lagi sawah-sawah di seputar kecamatan Singosari sekarang, akan hilang dan menjadi komplek perumahan. Atas dasar permasalahan tersebut di atas penelitian ini bermaksud mencoba untuk menggunakan Citra Landsat-7 Enchanced Thematic Mapper (ETM) untuk merekonstruksi situs keraton masa Hindu-Budha yakni bekas ibu kota Singhasari di wilayah Kecamatan Singosari, Kabupaten malang, Jawa Timur. Areal studi yang dipilih adalah situs yang diduga sebagai bekas ibu kota yakni situs Keraton Kerajaan Singhasari abad XIIIXIV, sebab situs keraton tersebut diambang kepunahan akibat maraknya pengembangan komplek perumahan, di samping itu sebagian besar areal situs masih berupa sawah (tidak tertutup bangunan) sehingga fenomenafenomena keberadaan suatu bekas bangunan dapat ditangkap menggunakan citra satelit. Hasil pengolahan data Citra dan Peta menunjukkan bahwa (a) Hasil pengolahan data peta menunjukkan bahwa daerah penelitian terletak di kaki gunung Arjuno; (b) Hasil pengolahan data Citra menunjukkan bahwa secara umum orientasi aliran sungai dan bangunan pada daerah yang diamati adalah arah Barat Laut menuju Tenggara. (c) Terdapat anomali arah bangunan dan pola sungai di sekitar Desa Singosari dan Pagetan; (d) Anomali arah bangunan disebabkan karena anomali aliran sungai; (e) Anomali aliran sungai merupakan hasil rekayasa manusia untuk pembuatan saluran irigasi; (f) Pembuatan saluran irigasi dilakukan pada jaman Kerajaan Singhasari; dan (g) Di daerah penelitian ditemukan sejumlah situs purbakala, jumlah situs yang paling banyak terdapat disekitar Desa Singosari serta Pegetan dan (h) Berdasarkan peta topografi yang dibuat Tahun 1811, temuan situs hasil groundtruth, an referensi peta-peta kuno, dapat dibuat rekonstruksi kondisi Desa Singosari dan Pagetan sekitar Awal Abad XVIII sampai awal Abad XX. Rekonstruksi situasi dan lokasi sekitar Singosari. Hasil kesimpulan didapat bahwa (a) Letak Keraton Singhasari berada di kaki Gunung Arjuno; (b) Pada Jaman Kerajaan Singhasari, orang telah mampu membuat saluran irigasi; (c) Kerajaan Singhasari diperkirakan

116 Abstrak Hasil Penelitian

berada di Desa Singosari dan Pegetan skarang ini; dan (d) Desa Pagetan diperkirakan merupakan komplek percandian, dan sepanjang jalan mulai dari Candi Singosari menuju ke Barat Laut, sampai ke makam di Desa Kadipaten diperkirakan merupakan pusat hunian dan pemerintahan Jaman Slnghasari. 113 Muksar, Makbul; Rahadi, Rustanto; Qohar, Abd. 2007. Selesaian Lemah Persamaan Hiperbolik Tak-Konveks dengan Metode Level Set

Kata-kata kunci: metode Level Set, selesaian lemah, persamaan hiperbolik takkonveks Level

Metode level set secara umum digunakan untuk menelusuri suatu batas dalam yang membagi domain menjadi dua bagian. Dalam penelitian ini akan dikaji penggunaan metode level set untuk menentukan selesaian lemah dan persamaan hiperbolik tak-konveks. Kajian ini sebagai lanjutan dari penggunaan metode level set untuk menetukan selesaian lemah dan persamaan hiperbolik yang koveks. Pertama akan diturunkan algoritma penggunaan metode level set terhadap persamaan hiperbolik tak-konveks. Kemudian akan dikaji selesaian lemah dan pensamaan hiperbolik takkonveks dengan menggunakan metode level set. Terakhir akan diberikan perbandingan hasil numenik selesaian lemah persamaan hiperbolik takkonveks yang menggunakan metode level set dengan metode penelusunan ketakkontinuan. 114 Amin, Mohammad; Wiyana, Aris; Rahayu, Sri. 2007. Identifikasi Genetik Kerbau Lokal Jawa Berbasis RLFP-DNA (Restriction Length Fragment Polymorphisms DNA): Strategi Awal Konservasi dan Upaya Penyediaan Bibit Unggul

Kata-kata kunci: kerbau lokal, RLFP-DNA, bibit unggul

Kerbau lumpur (Bubalus bubalis) lokal merupakan salah satu plasma nutfah dan jenis ternak yang memberikan kontribusi besar dalam penyediaan daging nasional untuk memenuhi kebutuhan protein hewani masyarakat dan keunggulan lain adalah tahan terhadap serangan penyakit. Seleksi negatif di tingkat peternak dan upaya pembibitan yang kurang diperhatikan mengakibatkan kerbau lokal yang tersisa adalah ternak-ternak yang kualitasnya kurang bagus yang kemudian terpaksa menjadi kerbau bibit. Dengan keadaan tersebut, diduga telah terjadi inbreeding di dalam populasi kerbau yang apabila berlangsung terus menerus akan meningkatkan jumlah individu

Edisi ke-27 Tahun 2008

117

homosigot di dalam populasi tersebut sehingga dapat menyebabkan menurunnya performansi fenotif misalnya ukuran tubuh, fertilitas dan daya tahan tubuhnya. Untuk menunjang keberhasilan upaya pelestarian dan konservasi serta pembibitan kerbau lumpur lokal, maka sangat perlu segera dilakukan identifikasi variasi fenotif dan variasi genetik berbasis molekuler dengan metode RFLP pada genom DNA dengan pertimbangan efisiensi waktu dan efektifitas pelaksanaan. Hasil penelitian tahun pertama hingga 5 Desember 2007 adalah diperoleh isolasi DNA dari sampel wilayah Jatim yang meliputi Blitar dan Banyuwangi sejumlah 49 sampel. Kemudian dilakukan optimasi suhu untuk PCR dengan tiga macam pasang primer yang terdiri dari: GHE5 F dan GHE5R (5` to 3`: TAGGGAGGGTGGAAAATGGA); GHPM1FgC dan GHPMIR 5` to 3`: GACACCTACTCAGACATTGCG dan GHPITF3 dan GHPMTRO (5` to 3`: GCGTAGCTACAGGTTGCAGTCCATGG GGTCGCTGAGGGCC. Suhu yang telah dicobakan adalah dengan: initial denaturation: 94 derajat C selama 2 menit, damplification (33 siklus), 94 derajat C selama 45 detik, 58 derajat C selama 30 detik, 72 derajat C selama 40 detik dan extension 72 derajat C selama 5 menit. Dengan suhu ini belum optimal dan terus dilakukan variasi suhu. Penelitian ini dalam jangka panjang berusaha untuk: (1) mengungkap keragaman fenotip kerbau lumpur lokal yang terdapat di beberapa daerah di Jawa; (b) mengkaji variasi genetiknya melalui analisis DNA dengan metode RFLP; dan (c). mengkaji hubungan variasi fenotip dengan variasi genetik tersebut. Penelitian di dilaksanaan dalam dua tahap yaitu tahap pertama untuk analisis fenotip kerbau lumpur lokal tahap kedua adalah analisis genetik dengan teknik RFLP. Fenotif yang diamati meliputi jenis kelaminnya, kemudian dicatat ciri-ciri fenotipnya antara lain umur, bentuk tubuh, ukuran kepala, panjang leher, warna tubuh, warna mata, bentuk dan panjang ekor, bentuk dan panjang tanduk, panjang kaki, lingkar badan dan panjang tubuh total. Untuk menentukan variasi genetik (polimorfisme, heterozigositasnya) data yang diperoleh dianalisis dengan software GENEPOP Pakcage. Hasil yang didapatkan kemudian dipaduan dengan analisis fenotip untuk menunjukkan keragaman populasi kerbau lumpur di Jawa. 115 Subandi; Muntholib. 2007. Identifikasi Sisi-Sisi Aktif Protein eRF1 melalui Isolasi dan Sekuensing Gen­Gen Mutan SUP45 dari Ragi Saccharomyces Cerevisiae

Kata-kata kunci: Protein eRF1, Ragi Saccharomyces Cerevisiae

118 Abstrak Hasil Penelitian

Protein eRF1 yang dikode oleh gen SUP45 berperan penting pada tahap akhir biosintesis protein, yaitu sebagai salah satu faktor terminasi translasi yang dominan Meskipun demikian mekanisme rinci dari peran eRF1 di atas masih belum jelas. Dengan studi struktur-fungsi yang dilanjutkan dengan analisis biokimiawi terhadap gen SUP45, diharapkan akan dapat diungkap mekanisme rinci peran protein eRF1 di atas. Dalam penelitian sebelumnya, oleh tim peneliti ini telah berhasil dikonstruksi 8 macam ragi mutan sup45 yang masing-masing mempunyai satu atau lebih fenotipe/ karakter yang berbeda dengan wild type-nya. Dengan demikian residu-residu asam amino yang termutasi di atas berperan penting/aktif dalam fungsi eRF1. Untuk mengetahui residu-residu mana saja yang termutasi/berperan penting tersebut, maka masing-masing gen mutan sup45 tersebut akan diisolasi dan disekuensing. Oleh karena masing-masing gen mutan sup45 di atas masih dalam bentuk plasmid (pUKC604) di dalam masing-masing ragi mutan, maka masing-masing plasmid tersebut akan diisolasi dari masingmasing ragi mutan, kemudian diperbanyak di E. coli dan disekuensing. Mengingat panjang gen SUP45 wild type adalah 1311 pb dengan urutan yang sudah diketahui, maka untuk mengurutkan (sekuensing) masingmasing gen mutan akan digunakan 4 (empat) macam primer yang dirancang sedemikian rupa sehingga seluruh gen akan terbaca dalam sekuensing. Setiap mutan akan mempunyai 4 (empat macam) data sekuensing yang selanjutnya akan dibandingkan dengan hasil sekuen gen SUP45 wild type menggunakan program computer (DNAStar) sehingga akan diketahui jenis dan posisi mutasi pada setiap gen mutan. Dengan demikian juga akan diketahui residu-residu asam amino protein eRF1 yang aktif berperan dalam fungsinya sebagai faktor terminasi translasi/biosintesis protein. Hasil penelitian menunjukkan bahwa ke-8 plasmid yang membawa gen mutan sup45 telah berhasil diisolasi, diidentifikasi dan diperbanyak. Sekuensing terhadap 3 macam isolat mutan menunjukkan bahwa pada mutan ke-3 dan ke-4 tidak ditemukan mutasi pada daerah `coding sequence` gen sup45. Kemungkinan mutasinya terjadi diluar coding sequence, misalnya di daerah promoter gen, yang dapat menyebabkan perubahan ekspresi gen tersebut, sehingga fenotipenya berbeda dari wild type. Sementara itu pada mutan no-1 ditemukan mutasi pada dua lokasi, yaitu kodon ke 196 dari Histidin menjadi Aspartat dan kodon ke 199 dari Valin menjadi Leusin . Oleh karena mutan tersebut berbeda fenotipenya dengan wild type, maka residu ke 196 dan ke 199 eRF1 merupakan salah satu sisi aktif protein tersebut.

Edisi ke-27 Tahun 2008

119

116 Wahyuningsih, Sapti; Andaini, Susy Kuspambudi. 2007. Implementasi Metode TSP dalam Program Komputer dan Analisis Kinerjanya

Kata-kata kunci: metode TSP, program komputer, analisis kinerja

Salah satu aplikasi teori graph yang banyak digunakan untuk memecahkan berbagai masalah yang terjadi dalam kehidupan sehari-hari adalah Traveling Salesman Problem. Traveling Salesman Problem permasalahan salesman harus mengunjungi beberapa kota dan kembali ke kota awal, dimana setiap kota harus dilewati tepat satu kali dengan jarak tempuh dan biaya yang seminimum mungkin. Dalam perkembangannya Traveling Salesman Problem banyak dimanfaatkan di berbagai bidang misalkan untuk mencari rute terpendek bus sekolah, mendesain sirkuit listrik, vehicle routing problem dan untuk masalah penugasan, dan sebagainya. Selama ini sudah banyak metode TSP yang bisa digunakan, baik untuk graf lengkap maupun tidak lengkap dengan sebarang titik. Beberapa mahasiswa jurusan Matematika FMIPA UM dalam skripsinya telah mengkaji metode Nearest Neighbor, Cheapest Link, Nearest Insertion, Farthest Insertion, Arbitrary Insertion, Matriks Bentuk Normal, dan Branch and Bound. Penelitian ini akan mengimplementasikan berbagai metode tersebut dalam program komputer serta melakukan kajian yang lebih mendalam tentang syarat cukup graphnya serta perbandingan masing-masing metode, dilihat dari sifat dan karakteristik graph yang digunakan, serta kelebihan dan kekurangannya. Implementasi dilakukan dengan menggunakan Borland Delphi. Input data dilakukan dalam bentuk penentuan titik-titik dengan mouse, dan pengisian bobot sisi ke dalam tabel yang disediakan. Sebagai output, lintasan Hamilton yang didapatkan juga divisualisasikan, beserta teks yang menunjukkan prosesnya. Untuk percobaan, digunakan graf tidak lengkap dengan 11 titik. Hasil eksekusi menunjukkan metode Farthest Insertion Search memberikan hasil yang lebih baik dari metode lainnya, sedangkan metode Branch and Bound gagal memberikan hasil karena matriksnya tidak dalam bentuk normal. Untuk analisa kinerjanya didapat temuan bahwa metode Matriks Bentuk Normal dan Branch and Bound tidak mensyaratkan adanya graf lengkap, sedangkan lima metode lain harus menggunakan graf lengkap. Metode Nearest Neighbor, Nearest Insertion, Farthest Insertion dan Arbitrary Insertion menggunakan pemilihan titik awal sehingga mungkin menghasilkan hasil yang berbeda untuk titik awal yang berbeda. Metode Nearest Neighbor dan Cheapest Link mungkin menghasilkan lebih dari satu lintasan karena

120 Abstrak Hasil Penelitian

adanya pemilihan sisi yang memiliki bobot sama, sedangkan metode Matriks Bentuk Normal juga mungkin menghasilkan lebih dari satu lintasan karena pemilihan titik yang berbeda pada baris dan kolom awalnya 117 Rahardjo, Swasono; Permadi, Hendro. 2007. Deteksi Kestasioneran dan Keinvertibelan Proses Autoregresif Integreted Moving Average (Arima) Secara Analitis

Kata-kata kunci: model ARIMA(p,d,q) invertibel, invers matriks autokovariansi, perilaku parameter

Perilaku parameter model ARIMA(p,d,q) stasioner dan invertibel secara analitis untuk p=2 dan q 2 dilakukan melalui polinom karakteristiknya. Untuk p dan q yang lebih dari 2, pendekatan polinom karakteristik tidak dapat dilakukan. Oleh karena itu penyelidikan perilaku parameter dikembangkan melalui invers matriks autokovariansinya (IMAc). Lebih lanjut, pendekatan ini memberikan perilaku parameter untuk sembarang nilai p dan q. Pendekatan ini dilakkukan dengan menyatakan secara eksplisit unsurunsur IMAc sebagai fungsi dari parameter model ARIMA(p,d,q). Ditambahkan pula suatu perlu dan cukup bagi suatu ARIMA(p,d,q) stasioner dan invertibel. 118 Sutrisno; Affandy, Dermawan; Sukariningsih, Dedek. 2007. Sintesis Turunan Asam Sinamat dan Uji Aktivitasnya sebagai Sunscreen

Kata-kata kunci: gen SUP45, mutasi gen, sekuensing gen

Senyawa bahan alam (natural product) dikenal sebagai chemical pointer karena keanekaragaman strukturnya. Keragaman struktur yang terdapat dalam bahan alam menimbulkan dampak pada fungsi, manfaat, dan potensi yang berbeda dan merupakan sumber informasi ilmiah yang sangat berharga. Asam sinamat (asam 3-fenilpropenoat) merupakan senyawa yang khas karena merupakan senyawa turunan benzena yang mengandung gugus karbonil tidak jenuh. Gugus karbonil tidak jenuh dan rantai hidrokarbon dalam asam sinamat merupakan gugus yang khas yang dapat digunakan sebagai sumber informasi ilmiah untuk mempelajari perilaku reaksi organik, khususnya reaksi substitusi kedua (second subtitution) dan reaksi esterifikasi senyawa yang mengandung cincin benzena pada gugus hidroksil polivisinal. Penelitian ini bertujuan untuk menggali bahan kimia hasil

Edisi ke-27 Tahun 2008

121

diversifikasi asam sinamat dan sebagai sumber kajian bahan alam asli Indonesia untuk bidang kefarmasian dan kosmetika. Penelitian ini bersifat eksperimental laboratorik yang terdiri dari tiga tahap. Tahap Pertama adalah sintesis turunan asam sinamat yang terdiri dari (1) esterifikasi dengan berbagai alkohol dan (2) nitrasi asam sinamat. Tahap Kedua adalah karakterisasi dan identifikasi senyawa turunan asam sinamat hasil sintesis. Tahap Ketiga adalah uji aktivitas senyawa turunan asam sinamat hasil sintesis sebagai tabir surya. Hasil penelitian menunjukkan bahwa (1) esterifikasi asam sinamat dengan isopropil alkohol mengindikasikan diperoleh isopropil sinamat (zat cair kental berwarna kekuningan, larut dalam kloroform, aseton, etil asetat, diklorometana, dan tidak larut dalam metanol dan air); (2) esterifikasi asam sinamat dengan glikol menghasilkan dua senyawa, yakni glikil hidroksil sinamat (zat cair kental berwarna kuning kecoklatan, larut dalam metanol, etanol, dan sukar larut dalam kloroform) dan glikil- , -disinamat padatan o berwarna kuning kecoklatan; titik lebur 118­120 C; larut sempurna dalam kloroform dan dietil eter, tetapi tidak larut dalam etanol, aseton dan asam asetat); (3) esterifikasi asam sinamat dengan gliserol menghasilkan gliseril sinamat (belum teridentifikasi); dan (4) nitrasi asam sinamat dengan HNO3/H2SO4 mengindikasikan dihasilkannya asam nitro sinamat (zat padat putih kekuningan, larut dalam metanol, etanol dan air, tidak larut dalam kloroform) Uji aktivitas tabir surya terhadap glikil- , -disinamat tidak menunjukkan potensinya sebagai bahan tabir surya. 119 Yuliati, Lia; Purwaningsih, Endang. 2007. Membangun Kemampuan Mengajar Calon Guru Fisika dengan Pembelajaran Berbasis Inkuiri di Jurusan Fisika Universitas Negeri Malang

Kata-kata kunci: calon guru fisika, membangun kemampuan mengajar, model pembelajaran berbasis inkuiri

Penelitian untuk mengembangkan model perkuliahan yang dapat membangun kemampuan mengajar calon guru fisika, khususnya kemampuan menerapkan model pembelajaran fisika sekolah telah dilakukan pada calon guru di Program Studi Pendidikan Fisika Jurusan Fisika FMIPA Universitas Negeri Malang. Model tersebut dinamakan Model Perkuliahan Kemampuan Mengajar Fisika Berbasis Inkuiri (MPKM-FBI) dan kemudian diukur efektivitasnya serta dijaring respons calon guru terhadap implementasi MPKM-FBI. Penelitian dilaksanakan dengan menggunakan desain research and development yang mencakup kegiatan (1) studi pendahuluan;

122 Abstrak Hasil Penelitian

(2) pengembangan model; dan (3) pengujian model. Data penelitian meliputi pelaksanaan model, skor nilai tes teori pembelajaran fisika, skor praktek mengajar, dan data respons calon guru. Data dikum-pulkan dengan menggunakan lembar observasi, tes, portofolio, angket dan catatan lapangan. Analisis data dilakukan dengan analisis gain score ternormalisasi dan uji z. Penelitian menghasilkan keluaran berupa dalil penelitian dan MPKM-FBI yang dapat membangun kemampuan mengajar calon guru fisika, khususnya kemampuan menerapkan model pembelajaran fisika sekolah. Hasil penelitian menunjukkan bahwa MPKM-FBI efektif untuk membangun penguasaan teori pembelajaran (<g>=0,34), kemampuan merancang pembelajaran, kemampuan melaksanakan pembelajaran, kemampuan mengevaluasi pembelajaran. Respons calon guru menunjukkan bahwa sebagian besar calon guru menyatakan setuju terhadap implementasi MPKM-FBI yang menggunakan siklus belajar 5-E, metode demonstrasi dan simulasi. 120 Suhadi; Wedhanto, Sonny. 2007. Identifikasi Daerah Tangkapan Air Tanah di Kabupaten Madiun

Kata-kata kunci: daerah tangkapan air tanah, kabupaten Madiun

Ada kecenderungan cadangan air tanah semakin berkurang akibat perubahan tata guna lahan, ironisnya dari waktu ke waktu jumlah penduduk yang menjadi konsumen utama air tanah selalu meningkat. Salah satu upaya untuk melestarikan cadangan air tanah adalah melakukan evaluasi tempat tangkapan air tanah yang ada tidak berubah fungsi, sebab daerah tersebut merupakan tempat mereesapnya air hujan ke dalam tanah. Evaluasi daerah tangkapan air tanah mencakup kawasan yang sangat luas, sehingga pelaksanaannya akan lebih ekonomis jika dilakukan menggunakan teknik penginderaan jauh. Tujuan penelitian adalah melakukan evaluasi lokasi daerah tangkapan air tanah di kabupaten Madiun dengan teknik inderaja. Pengump[ulan data + terutama dilakukan dari analisis Citra Landsat 7 ETM dan peta rupa bumi + Indonesia skala 1:25.000. Citra Landsat 7 ETM digunakan untuk memperoleh data sebaran batuan, peta rupa bumi Indonesia digunakan untuk memperoleh data arah aliran air hujan dan pola sungai. Pola data citra menggunakan teknik klasifikasi terselia dan pengolahan data peta dengan digitasi on screen. Hasil akhir penelitian berupa peta daerah tangkapan air tanah, peta dibangun dengan metode tumpang susun dari tiga peta hasil pengolahan data yaitu: (1) Peta Kemampuan penyerapan air; (2) Peta arah aliran auir hujan; dan (3) Peta sungai.

Edisi ke-27 Tahun 2008

123

Hasil penelitian menunjukkan bahwa lokasi daerah tangkapan air tanah di kabupaten madiun Madiun terletak di sekitar Gunung Wilis, pada media tanah piroklastik yang mudah terkena erosi. Dikawatirkan jika vegetasi di daerah ini, daerah tersebut rawan longsor, oleh sebab itu perlu mempertahankan keberadaan vegetasi di daerah tangkapan air tanah tersebut. 121 Sutrisno; Issutarti. 2007, Normalisasi Keluaran Sensor Pola Rasa terhadap Hasil Identifikasi Rasa Larutan Suatu Zat

Kata-kata kunci: alat pengecap rasa, normalisasi keluaran sensor pola rasa.

Telah dibuat alat pengecap rasa dengan keluaran sensor yang telah dinormalisir, sehingga alat ini sesuai dengan cara kerja dan fungsi dari masing-masing bagian sistem yang sesuai dengan prosedurnya. Hasil yangdiperoleh sebagai berikut (1) metode normalisasi dapat menstabilkan keluaran sensor yang tidak ajeng dalam waktu yang berlainan/berbeda; (2) pola keluaran sensor rasa yang sudah dinormalisir ini dapat membedakan pola rasa dari larutan rasa (tawar, asin ,manis, dan masam); dan (3) program sistem pakar dapat digunakan dalam mendeteksi pola rasa suatu larutan akan tetapi hal ini tergantung dari data base yang digunakan pada saat pengenalan pola rasa. Dari hasil penelitian disarankan untuk dapat melihat kemampuan seberapa besar alat mampu mendeteksi berbagai macam rasa perlu dilakukan penelitian lebih lanjut. Hal ini tergantung dari kemampuan program sistem pakar dalam mengklasifikasi pola rasa dan batasan keluaran sensor yang diijinkan (batas atas dan batas bawah). Oleh sebab itu diusulkan penelitian tahap ke 2 yaitu, Pengenalan Pola Rasa Dari Suatu Larutan Untuk Berbagai macam Rasa Campuran menggunakan Program Sistem Pakar. 122 Pribadi; Wasis. 2007. Kajian Aspek Teknologi dan Kultural Model Saluran dan Bangunan Irigasi Subak: Studi Kasus pada Organisasi Subak di Kabupaten Tabanan-Bali

Kata-kata kunci: teknologi, kultural, irigasi, subak

Penelitian ini bertujuan menghasilkan seperangkat informasi tentang model teknologi saluran dan bangunan irigasi subak. Penelitian ini tergolong penelitian kualitatif dengan pendekatan etnografi, yang berusahan untuk memerikan kebudayaan, berusaha memahami individu-individu menciptakan

124 Abstrak Hasil Penelitian

dan memahami kehidupan sehari-hari mereka, cara mereka menyelesaikan pekerjaan dalam hidup sehari-hari. Berdasarkan atas analisis hasil penelitian dapat disimpulkan sebagai berikut: (1) teknologi saluran dan bangunan irigasi subak yang ada merupakan teknoklogi trasional yang sederhana; (2) sistem pemeliharaan saluran dan bangunan irigasi diatur menurut pembagian wilayah kerja, untuk jaringan utama/telabah gede (saluran primer) oleh seluruh anggota subak atau sekeha yeh, pada jaringan cabang/ telabah cerik (saluran skunder) oleh anggota yang mendapat air dari jaringan ditingkat cabang; dan (3) terdapat hubungan antara aturan/sistem adat masyarakat setempat, dengan sistem teknologi saluran dan bangunan irigasi serta sistem pemeliharaannya 123 Wena, Made; Adi , Kukuh Johar Wahyu. 2007. Pemodelan Pengelolaan Risiko dalam Pembangunan Proyek Perumahan Kelas Menengah

Kata-kata kunci: risiko, perumahan, proyek

Tujuan penelitian ini akan menghasilkan seperangkat bangunan informasi empirik tentang model pengaruh risiko-risiko proyek terhadap sasaran proyek dalam pembangunan rumah kelas menegah. Penelitian ini menggunakan rancangan survei, mengingat cakupan wilayah yang cukup luas Kota Malang, Surabaya, dan Sidoarjo. Penelitian ini bersifat hubungan kausal (causal relationship) yang bertujuan untuk menguji hubungan antara variabel-variabel risiko dengan sasaran proyek. Berdasarkan hasil analisis data disimpulkan bahwa terdapat cukup bukti untuk menyimpulkan bahwa terdapat pengaruh yang signifikan antara variabel risiko proyek terhadap sasaran proyek. 124 Karyadi; Umniati, B. Sri; Nindyawati. 2007. Pengaruh Bentuk Pengekang di Jalur Gaya Tekan Penampang Balok Beton Bertulangan Bambu terhadap Kapasitas Beban dan Lendutan Balok pada Rasio Tulangan yang Berbeda

Kata-kata kunci: kotsovos, kapasitas lentur, beton terkekang, tulangan bambu

Bambu sebagai alternatif pengganti bahan tulangan baja sangat menarik untuk diteliti karena memiliki beberapa keuntungan. Dari segi kekuatan, kuat tarik bambu jenis galah sebesar 253 Mpa menyamai kuat tarik baja tulangan yang berkisar antara 240 Mpa hinga lebih dari 400 MPa. Dari segi ekonomi, harga bambu jauh lebih murah dibandingkan tulangan

Edisi ke-27 Tahun 2008

125

baja untuk tingkat kekuatan yang sama. Sedangkan dari segi ketersediaannya, bambu merupakan sumber daya alam yang dapat diperbaharui. Untuk tujuan meningkatkan kapasitas lentur suatu elemen struktur dapat dilakukan dengan mengekang beton pada daerah tekannya. Tujuan utama dari studi ini adalah untuk menyelidiki pengaruh bentuk pengekang pada jalur gaya tekan beton terhadap kapasitas lentur dan daktilitas balok beton mutu normal bertulangan bambu pada rasio penulangan 5% dan 6%. Sejumlah 18 buah benda uji balok beton bertulangan bambu dengan ukuran 130 x 150 x 1800 mm dibuat untuk uji lentur. Mutu beton yang digunakan adalah 34,565 MPa. Bambu, dari jenis bambu petung, digunakan hanya pada tulangan longitudinal, sedangkan sebagai pengekang (tulangan transversal) digunakan sengkang baja dengan diameter 6 mm. Pengekang berbentuk sengkang segiempat dan lingkaran (spiral). Jarak pengekang digunakan 50 mm. Rasio penulangan longitudinal digunakan 5% dan 6 %. Benda uji dibuat dalam 6 kelompok yang masing-masing berjumlah 3 buah. Balok diletakkan di atas tumpuan sendi-rol. Dibebani oleh dua beban terpusat dengan jarak 600mm dari tumpuan. Besar lendutan yang terjadi dan lebar retak diukur pada penampang di tengah bentang. Hasil studi menunjukkan bahwa peningkatan rasio tulangan bambu dari 5% menjadi 6% yang disertai dengan pengekangan pada jalur tekan secara signifikan meningkatkan kemampuan balok beton bertulang bambu dalam memikul beban lentur. Selanjutnya juga diperoleh bahwa perbedaan bentuk pengekang tidak berpengaruh secara signifikan terhadap peningkatan kemampuan balok beton bertulang bambu dalam memikul beban lentur. Temuan lainnya dalam penelitian ini adalah bahwa keberadaan pengekang pada jalur tekan dan peningkatan rasio tulangan bambu dari 5% menjadi 6% tidak berpengaruh secara signifikan terhadap lendutan balok. 125 Thoyibatun, Siti; Mentari, Sriyani. 2007. Analisis Pengaruh Penguasaan Saham oleh Investor Institusi, Earning, Volatility, Rdad, dan Dividen terhadap Kebijakan Hutang dan Kepemilikan Saham Manajerial: dalam Perspektif Teori Agency

Kata-kata kunci: saham dan manajer, Bursa Efek Jakarta, gency problem

Theory of the firm (Jensen dan Meckling, 1976) mencoba memodelkan organisasi atau perusahaan sebagai sebuah hubungan kontrak antar prinsipal (pemberi amanah) dengan manajer (selaku penerima amanah). Model demikian memandang adanya pemisahan kekuasaan antara fungsi kepemilikan dan fungsi pengelolaan perusahaan. Pemisahan kekuasaan

126 Abstrak Hasil Penelitian

dalam perusahaan sebagai fungsi pengelola dan fungsi pemilik berakibat munculnya keadaan yang rentan terhadap konflik. Konflik ini mulai muncul ketika kepentingan manajer tidak lagi sesuai dengan kepentingan pemilik. Jensen dan Meckling (1976) mengidentifikasi adanya dua konflik, yaitu konflik antara pemegang saham dan manajer, dan konflik antara pemegang ekuitas dan pemberi hutang. Untuk menyelaraskan kepentingan tersebut pihak eksternal perlu mengeluarkan biaya yang disebut agency cost. Agency cost dapat dibatasi dengan berbagai alternatif, yaitu (1) meningkatkan dividend payout ratio; (2) kepemilikan saham manajerial; (3) pendanaan dengan hutang; dan (4) kepemilikan saham institusional sebagai agen monitoring. Penelitian ini bertujuan untuk mengetahui pengaruh atau keterkaitan diantara mekanis-mekanisme yaitu kebijakan hutang, kepemilikan saham manajerial dan institusional beserta variabel yang mempengaruhnya, sehingga dapat dicapai keseimbangan yang optimal dalam upaya mengurangi agen siklos. Sampel penelitian adalah perusahaan manufaktur yang go public di BEJ dengan kriteria sahamnya dimiliki institusional dan manajerial, sehingga diperoleh 40 perusahaan. Teknis analisis data yang digunakan adalah regresi linier berganda yang terdiri dari dua persamaan regresi. Dari hasil penelitian ditemukan bahwa:(1) terdapat pengaruh secara simultan antara variabel divident payout ratio, earning volatility, kepemilikan saham institusional, stock return volatility, RDAD terhadap kebijakan hutang dan kepemilikan saham manajerial, (2) divident payout ratio berpengaruh terhadap kebijakan hutang, dan (3) divident payout, institutional ownership, stock return volatility berpengaruh terhadap managerial ownership. Kesimpulan pengertian ini bahwa antara kebijakan hutang, kepemilikan saham manajerial, dan kepemilkan saham institusional tidak terdapat hubungan kausalitas. 126 Wardoyo, Cipto; Khusaini, Moh. 2007. Analisis Penerapan Emotional Quotien (EQ) dalam Aspek Kurikulum Berbasis Kompetensi (KBK)

Kata-kata kunci: kecerdasan emosi, KBK, aspek pembelajaran

Penelitian ini bertujuan untuk (1) Mengetahui sejauh mana perkembangan pendidikan saat ini yang ditunjang dengan Kurikulum 2004 (KBK); (2) Mengerti dan juga mengetahui seberapa besar proporsi antara EQ dan IQ dalam aspek pembelajaran KBK; dan (3) Mengetahui apakah Kurikulum 2004 (KBK) tidak hanya mengembangkan IQ tetapi juga EQ.

Edisi ke-27 Tahun 2008

127

Metode analisis data yang digunakan pada penelitian ini adalah metode analisis deskriptif kualitatif, yaitu data yang diperoleh kemudian disusun, sehingga mempermudah pembahasan masalah-masalah yang ada. Karena titik terfokus penelitian ini adalah penelitian berbasis literatur (pustaka), maka data yang dikumpulkan merupakan data kualitatif (non angka). Penerapan sistem pendidikan di Indonesia terdahulu lebih menekankan pada kecerdasan intelektual semata. Akan tetapi, KBK seharusnya dapat mengintegrasikan antara kecerdasan intelektual dan kecerdasan emosi secara seimbanq melalui ketiga aspek dalam KBK yaitu aspek kognitif, afektif dan psikomotor. Penerapan EQ dalam KBK dapat dilihat dari penilaian yang dilakukan terhadap ketiga aspek KBK diatas. Penilaian yang dimaksud adalah penilaian unjuk kerja, tingkah laku, portofolio, dan produk. Sehingga dengan adanya penerapan tersebut, siswa diharapkan dapat mengaplikasikannya kedalam kecakapan hidup (Life Skill). Maka dari penjelasan tersebut dapat disimpulkan bahwa: (1) Sistem KBK sudah dilaksanakan di Indonesia, namun penerapannya sering kali masih memiliki banyak kendala, seperti fasilitas pembelajaran, kemampuan tenaga pengajar, kurangnya sosialisasi yang tepat dari pemerintah, dan lain sebagainya; (2) Agar dapat diaplikasikan kecakapan hidup (life skill), maka KBK harus memiliki proporsi sebanyak 80% pembentukan kemampuan afektif yang secara langsung bersing-gungan dengan pembentukan Emotional Quotient (EQ) dan sisanya sebanyak 15% dan 5% terdiri dari kemampuan psikomotor dan kemam-puan kognitif, dimana keduanya bersinggungan langsung dengan pembentukan kemampuan Intelligence quotient (IQ); dan (3) Penerapan KBK pada saat ini masih lebih mengedepankan pengembangan kemampuan kognitif dibandingkan dengan pengembangan kemampuan afektif yang erat kaitanya dengan pembentukan EQ. 127 Andajani, Kusubakti; Dawud. 2007. Kesantunan dalam Tindak Tutur Impositif Memerintah Anak Usia Sekolah Dasar

Kata-kata kunci: tindak memerintah, wujud tuturan, strategi, kesantunan

Ditengarai, iklim demokratis yang diciptakan sebagian besar keluarga muda Jawa dewasa ini berdampak pada bergesernya penerapan nilai-nilai budaya Jawa dalam lingkungan keluarga tersebut, khususnya dalam hal kesantunan berbahasa. Tujuan penelitian ini adalah mendeskripsikan wujud,

128 Abstrak Hasil Penelitian

strategi, dan kesantunan tindak tutur impositif memerintah anak usia sekolah dasar yang dibesarkan dalam iklim demokratis. Penelitian ini merupakan penelitian deskriptif kualitatif, dengan sumber data anak usia awal dan akhir sekolahdasar yang hidup dalam lingkungan keluarga demokratis. Secara umum, hasil penelitian menunjukkan bahwa budaya Jawa cukup mereduksi nilai demokratis yang niatnya ditanamkan dalam pola pikir anak. 128 Hidayah, Nur; Triyono; Setyosari, Punadji. 2007. Pengembangan Model Konseling Kolaboratif Berbasis ICT

Kata-kata kunci: model konseling kolaboratif, SRL, ICT

Bimbingan dan konseling adalah wilayah layanan yang bertujuan memandirikan individu yang normal dan sehat dalam menavigasi perjalanan hidupnya melalui pengambilan keputusan termasuk yang terkait dengan keperluan untuk memilih, meraih serta mempertahankan karier untuk mewujudkan kehidupan yang produktif dan sejahtera, serta untuk menjadi warga masyarakat yang peduli kemaslahatan umum (the Common Good) melalui pendidikan (Strenberg, 2003). Dalam rangka implementasi layanan konseling, konselor sebagai seorang ahli harus mampu menggunakan dan mengembangkan media bimbingan dan konseling, terutama berbasis ICT (Information and Communication Tegnology), serta menguasai khasanah teoritik dan prosedural termasuk tegnologi dalam bimbingan dan konseling (ABKIN, 2005; 2007). Kerangka kerja konseling kolaboratif yang digunakan dalam penelitian ini dalah kerangka kerja konseling pada umumnya (dalam hal ini model-model konseling modern, orientasi kognitif-behavioral), yang menekankan pada perilaku belajar kolaboratif dan SRL dengan menggunakan ICT. Kemampuan dalam mengembangkan dan menggunakan media konseling berbasis ICT merupakan kebutuhan yang subtancial bagi pengembangan profesionalitas konselor yang berkelanjutan. Oleh karena pentingnya media konseling ini, maka fokus tujuan penelitian tahun 2007 ini adalah mengidentifikasi dan mengkategorisasikan kebutuhan konselor akan model Konseling Kolaboratif Berbasis ICT, utamanya pada empat komponen model yaitu konseling, belajar kolaboratif, SRL, dan ICT. Penelitian Pengembangan Model Konseling Kolaboratif Berbasis ICT ini, menggunakan rancangan penelitian adalah 8 orang konselor SMP Negeri dan MTs Negeri Kota Malang. Instrumen penelitian adalah kuesioner kebutuhan terhadap kemampuan konsuler dalam Konseling Kolaboratif Berbasis ICT. Ada 4 komponen kebutuhan konselor yaitu: (1) konseling; (2)

Edisi ke-27 Tahun 2008

129

belajar kolaboratif; (3) SRL; dan (4) ICT. Spesifikasi produk pada tahun I, 2007 adalah Profil kebutuhan Konseling Kolaboratif Berbasis ICT. Hasil penelitian tentang kebutuhan konselor dalam konseling kolaboratif berbasis ICT adalah (1) kebutuhan konselor dalam konseling cenderung tinggi dari ketiga komponennya. Dengan rincian, bahwa kebutuhan konselor akan pengetahuan dan pemahaman, sikap dan nilai, dan keterampilan dalam konseling, ketiga-tiganya cenderung tinggi (87.5%); (2) sebagian besar kebutuhan konselor dalam belajar kolaboratif cenderung tinggi yaitu pada komponen membentuk kelompok, bekerja sebagai kelompok, dan pemecahan masalah. Namun kebutuhan konselor akan belajar kolaboratif dalam mengelola perbedaan ditemukan rendah (87.5%); (3) kebutuhan konselor dalam SRL cenderung tinggi pada semua komponennya, sekalipun secara rinci ada perbedaan angka Persentasinya. Ditemukan bahwa kebutuhan konselor akan SRL dalam startegi metakognisi tinggi (100%); SRL dalam startegi mengingat tinggi (67.5%); SRL dalm memperluas pemahaman tinggi (75%); SRL dalam mengorganisir bahan tinggi (75%); SRL dalam kemampuan mengatur perilaku tinggi (87.5%); dan (4) kebutuhan konselor akan pemahaman dan keterampilan dalam ICT ditemukan rendah (62.5%), meskipun sebagian kecil (37.5) mereka membutuhkannya sebagai alat bantu konseling. Dengan demikian semua komponen tersebut tetap dipertimbangkan dalam pengembangan model konseling ini. Sekalipun komponen ICT belum menjadi prioritas mereka, disebabkan mayoritas mereka gagap tegnologi. Berdasarkan temuan penelitian tentang kebutuhan konselor dalam Konseling Kolaboratif Berbasis ICT, utamanya dalam mengawali aplikasi model ini, maka sasaran yang perlu dipertimbangkan terutama dalam hal: (1) Perlunya mengenalkan ICT kepada para konselor dalam mengelola dalamketrampilan belajar kolaboratif dan meningkatkan SRL konseli. Agar para konselor menjadi melek tegnologi, disamping ICT dikenali sebagai ,media konseling; (2) Pengembangan procedural penggunaan media konseling berbasis ICT yang akan dikembangkan dibuat semudah mungkin sekalipun, diharapkan dapat mencukupi bagi pengoperasian media konseling ini; dan (3) Refleksi pengalaman penggunaan media perlu dilakukan secara periodic untuk keperluan revisi. Oleh karena itu, penelitian pengembangan semacam dapat dilakukan dengan mengedepankan aspek kemengapaan konselor bersikap enggan mengakrabi, mengenali lebih dekat, media omputer sebagai alat Bantu konseling, sehingga mempermudah kelancaran tugas sehari-harinya.

130 Abstrak Hasil Penelitian

129 Budiwanto, Setyo; Winarno; Adi, Sapto; Januarto, Ony Bagus. 2007. Pengembangan Video Pembelajaran Keterampilan Bulu Tangkis

Kata-kata kunci: video pembelajaran, bulutangkis

Permainan Bulutangkis merupakan salah satu matakuliah gerak atau praktek pada Jurusan Ilmu Keolahragaan. Salah satu tujuan pembelajaran dalam mata kuliah bulutangkis adalah mahasiswa menguasai keterampilan teknik bulutangkis. Untuk mencapai tujuan pembelajaran, diperlukan kegiatan belajar mengajar yang efektif dan. efisien yaitu memanfaatkan sumber belajar yang tepat. Salah satu sumber belajar yang penting dan tepat dimanfaatkan dalam kegiatan belajar mengajar keterampilan teknik bulutangkis adalah media pembelajaran. Media yang paling cocok dengan karakteristik pembelajaran ketrampilan teknik bulutangkis adalah video pembelajaran ketrampilan teknik bulutangkis. Dengan mengunakan media berupa video pembelajaran keterampiIan teknik bulutangkis ini banyak manfaat yang diperoleh Yaitu (1) Dapat membantu dosen dalam menerapkan metode demonstrasi tentang materi keterampilan teknik bulutangkis; (2) tayangan video dapat diulang-ulang secara konnsisten; (3) membantu mahasiswa dalam melakukan proses persepsi dan konsep dengan benar tentang materi keterampilan teknik bulutangkis; (4) Dgunakan mahasiswa atau pembelajar dalam kegiatan belajar mandiri; (5) Memberikan pengalaman dan motivasi belajar mahasiswa secara intergral dan konkrit; dan (6) Untuk mengatasi terjadi kendala-kendala an keterbatasan dalam proses pembelajaran ketrampilan gerak. Berdasarkan manfaat dan untuk memenuhi kebutuhan media pembelajaran yang tepat dan efektif maka perlu dikembangkan media pembelajaran berupa video pembelajaran ketrampilan teknik dasar bulutangkis. Sebagai tahap awal perlu disusun skrip/skenario video pembelajaran ketrampilan teknik dasar buutangkis melalui penelitia pengembang. Produk utama pengembangan ini adalah video pembelajaran ketrampilan bulutangkis. Untuk menghasilkan produk utama tersebut,lebih dahulu perlu dilakukan tahap pengembangan skrip/skenario video pembelajaran ketrampilan bulutangkis. Tujuan pengembangan pada penelitian tahap pertama ini adalah mengembangkan skrip/skenario video pembelajaran ketrampilan bulutangkis. Metode penelitian yang digunakan adalah metode penelitian dan pengembangan dengan model pengembangan prosedural, pendekatan deskriptif developmental dan survei. Langkah-langkah pengembangan terdiri

Edisi ke-27 Tahun 2008

131

dari (1) menyusun dan uji coba instrumen inventori untuk mengumpulkan data analisis kebutuhan; (2) menentukan subyek penelitian sebagai responden untuk mengumpulkan data analisis kebutuhan; (3) mengumpulkan data analisis kebutuhan (4)Menganalisis hasil pengumpulan data tentang analisis kebutuhan; (5) menyusun skrip/skenario video pembelajaran ketrampilan bulutangkis sebagai bentuk produk berdasarkan hasil analisis kebutuhan; (6) mengkaji dan konsultasi produk awal skrip/skenario pembelajaran ketrampilan bulutangkis kepada ahli pembelajaran pendidikan jasmani; dan (7) revisi skrip/skenario video pembelajaran ketrampilan bulutangkis. Subyek penelitian ini adalah (1) Mahasiswa Ilmu Keolahragaan; (2) Atlet bulutangkis; (3) Dosen mata kuliah bulutangkis; (4) Pelatih bulutangkis; dan (5) Pakar pembelajaran pendidikan jasmani. Instrument yang digunakan adalah (1) inventori untuk mengumpulkan data tentang analisis kebutuhan; (2) focus group discusion untuk menyusun skrip/skenario video pembelajaran ketrampilan bulutangkis; dan (3) format penilaian menggunakan skala rating untuk mengumpulkan data kajian dan konsultasi pakar pembelajaran pendidikan jasmani. Teknik analisis data yang digunakan adalah pendekatan deskriptif dan analisis kualitatif. Kesimpulan hasil analisis kebutuhan adalah (1) Penyusunan video pembelajaran bulutangkis merupakan salah satu kebutuhan bagi mahasiswa dan atlet dalam proses pembelajaran dan pelatihan; (2) Penyusunan skrip/skenario video pembelajaran keterampilan bulutangkis perlu dilengkapi dan memperhatikan beberapa hal yaitu struktur materi setiap teknik dasar bulutangkis dalam skrip/skenario video pembelajaran keterampilan bulutangkis harus memuat kunci-kunci gerkan teknik dasar bulutangkis secara rinci; perlu dilengkapi dengan tayangan bentuk-bentuk latihan mengulang-ulang (drilling); perlu dilengkapi tayangan gerakan lambat (slow motion); perlu penjelasan tentang sudut pengambilan gambar tayangan yang diinginkan; perlu dilengkapi narasi; dan (3) Tingkat keterampilan teknik bulutangkis yang disajikan dalam materi skrip/skenario video pembelajaran keterampilan teknik bulutangkis adalah keterampilan tekinik dasar bulutangkis. Hasil pengembangan adalah skrip/skenario video pembelajaran keterampilan teknik dasar bulutangkis yang memuat macam-macam keterampilan teknik dasar bulutangkis: (1) teknik dasar cara pegang raket (grip); (2) teknik dasar langkah kaki (foot work); (3) teknik dasar sikap siaga menerima pukulan; (4) teknik dasar pukulan forehead service; (5) teknik dasar pukulan backhand service; (6) teknik dasar sikap siaga menerima service; (7) teknik dasar pukulan forehand overhead lob; (8) teknik dasar

132 Abstrak Hasil Penelitian

pukulan backhand overhead lob; (9) teknik dasar pukulan forehand underhand lob (dari dekat net); (10) teknik dasar pukulan backhand underhand lob (dari dekat net); (11) teknik dasar pukulan forehand smash; (12) teknik dasar pukulan forehand overhead dropshot; (13) teknik dasar pukulan backhand overhead dropshot; (14) teknik dasar pukulan forehand underhand dropshot; (15) teknik dasar pukulan backhand underhand dropshot; (16) teknik dasar pukulan forehand drive; (17) teknik dasar pukulan backhand drive; (18) teknik dasar pukulan forehand net drop; dan (19) teknik dasar pukulan backhand net drop. 130 AT, Andi Mappiare; Ibrahim, Abd. Syukur; Ramli, M.; Sudjiono. 2007. Kultur Konsumsi Remaja dan Upaya Bimbingannya (Studi Perspektif Posmodern Mengenai Pembelanjaan Pelajar Kota Metropolitan Pantai Indonesia untuk Pengembangan Media Bibliokonseling)

Kata-kata kunci: pelajar kota metropolitan, pengembangan media biblio-konseling

Penelitian ini dilatarbelakangi fakta mengenai kultur konsumsi remaja dan pengaruh media massa, iklan, dan pergaulan sosial remaja sebagai suatu problema yang perlu dipahami oleh pendidik. Pemahaman yang lengkap dan gamblang dapat menghasilkan suatu penjelasan teoretik bidang konseling pendidikan, kebijakan pendidikan antisipatif, dan bahan solusi yang jelas dan tepat. Penelitian Th-I ini bertujuan agar diperoleh deskripsi naratif mengenai: (1) apa pola pemikiran remaja-pelajar, subjek penelitian, terkait perilaku konsumtif mereka? dan (2) bagaimana kultur bekerja dalam kelola-diri terkait dorongan konsumtif mereka? Penelitian Th-I menggunakan metode kualitatif varian etnografi terfokus, strategi interpretasi kritik intensif, "an intensive critical interpretations", atau "close reading" (Alvesson dan Skoldberg, 2000: 141). Penelitian dilakukan pada lokasi beberapa kota metropolitan pantai Indonesia (Banda Aceh, Surabaya, dan Makassar) dengan subjek siswa SMA. Sampling lokasi dilakukan secara purposive dan sampling subjek dengan teknik snowballing. Analisis dilakukan dengan membaca dekat data dari ketiga lokasi dan masing-masing dideskripsikan: (a) konteks sosio-kultur penelitian dan (b) uraian data dan reduksi fenomenal (lapangan). Kemudian dilakukan inti analisis, yaitu interpretasi deskriptif, meliputi: interaksi data reduktif, interpretasi makna, deskripsi makna, dan kategorisasi makna. Kesimpulan penelitian ini adalah: (1) Mengenai pola pemikiran subjek, berperan konsep Kecerdasan Pembelanjaan (budgeting intelligence): (a)

Edisi ke-27 Tahun 2008

133

Kecerdasan Tinggi dalam Pembelanjaan, berbelanja secara mewah dan rasional; (b) Kecerdasan Cukup dalam Pembelanjaan, berbelanja secara hemat dan rasional; dan (c) Kecerdasan Rendah dalam Pembelanjaan, berbelanja secara mewah namun tidak rasional; (1) Mengenai kerja kultur dalam kelola-diri terkait dorongan konsumtif remaja ditemukan konsep Kebijaksanaan Kultural; (a) Sangat Bijaksana secara Kultural, nilai agama/adat terinternalisasi secara metodis; (b) Cukup Bijaksana secara Kultural, nilai agama/adat terinternalisasi secara natural; dan (c) Tidak Bijaksana secara Kultural, nilai agama/adat tidak terinternalisasi. Inti abstraksi temuan penelitian ini adalah: dalam kehidupan ekonomi remaja, yang penting bukanlah hidup hemat seperti ungkapan hemat pangkal kaya melainkan kecerdasan pembelanjaan ("butgeting inteligence") dan kebijaksanaan kultural ("cultural wisdom"). Dari kesimpulan itu diajukan saran-saran kepada pengelola pendidikan lembaga persekolahan dan pengambil kebijakan pendidikan untuk mengidentifikasi, mengonsep dan mengaplikasikan nilai-nilai kultur lokal untuk meningkatkan kecerdasan pembelanjaan dan kebijaksanaan kultural terkait kelola belanja remaja-pelajar. Hasil nyata penelitian ini adalah tersusunnya buku bacaan populer, novel, dalam bahasa yang gamblang dan dapat menggugah pemikiran remaja-pelajar untuk memiliki pola pemikiran rasional dalam belanja dan mengupayakan internalisasi kultur secara bijaksana. 131 Roesdiyanto; Sulistyorini; Huda, Abdul. 2007. Pengembangan Pembelajaran Pendidikan Jasmani Menggunakan Pendekatan Kecerdasan Majemuk untuk Anak Usia Dini di Jawa Timur

Kata-kata kunci: pendidikan jasmani, kecerdasan majemuk

Penelitian ini berorientasi pada pengadaan buku yang dapat digunakan sebagai sumber belajar tercetak bagi guru dalam mengajar pendidikan jasmani mengunakan pendekatan kecerdasan majemuk. Tujuan penelitian adalah: (1) Melakukan analisis kebutuhan perlunya bentuk-bentuk permainan; (2) Menemukan karakteristik permainan serta: dan (3) Mengembangkan buku permainan dengan pendekatan kecerdasan majemuk pada pendidikan jasmani untuk anak usia dini. Metode penelitian menggunakan penelitian pengembangan (development research) dari Borg and Gall, dengan rancangan survey, untuk memperoleh data (a) Kebutuhan model pembelajaran untuk anak usia dini; (b) Data karakteristik model pembelajaran; (c) Faktor pendukung/peng-

134 Abstrak Hasil Penelitian

hambat pengembangan model; dan (d) Kebutuhan alat bantu pembelajaran. Subyek penelitian Guru TK sebanyak 42 orang di 7 kota/kabupaten Jawa Timur, dan rancangan pengembangan dengan subyek guru TK di Malang, ahli pendidikan jasmani, ahli pendidikan, ahli psikologi pendidikan. Hasil berupa (1) Buku panduan teori; (2) Buku model-model permainan yang berisi perancangan, pengorganisasian berdasarkan kecerdasan majemuk terdiri dari (a) Permainan sirkuit cerdas; (b) Permainan estafet ceria; dan (c) Permainan lalu lintas; dan (3) VCD model-model permainan berdasarkan kecerdasan majemuk. 132 Prantiasih, Arbaiyah; Untari, Sri; Rochmadi, Nur Wahyu; Hakim, Suparlan Al. 2007. Pengembangan Model Panduan Bekerja di Luar Negeri bagi Tenaga Kerja Wanita di Wilayah Kabupaten Malang

Kata-kata kunci: pengembangan, model panduan bekerja, di luar negeri, tenaga kerja wanita

Penelitian ini didasarkan pada relita bahwa fwnomena buruh migran khususnya tenaga kerja wanita yang bekerja di luar negeri ternyata syarat dengan problematik, mulai dari lemahnya perlindungan, korban penipuan calo, Perusahaan Pengerah Jasa Tenaga Kerja Indonesia (PJTKI), pemerasan bahkan sampai pelanggaran HAM acap kali mewarnai fenomena buruh migran khususnya tenaga kerja wanita mulai proses perekrutan, pelatihan, pengurusan dokumen, saat pemberangkatan, sesampainya di negara tujuan bahkan sampai pada saat kedatangan kembali ke tanah air. Tujuan penelitian ini adalah mengidentifikasi identitas diri buruh migran perempuan; mendeskripsikan sistem dan bentuk rekrutment yang dilaksanakan PJTKI; mendeskripsikan sistem layanan dan bentuk pengadministrasiannya; mendeskripsikan bentuk perlindungan bekerja di luar negeri; khususnya prototype panduan bekerja bagi tenaga kerja wanita yang akan bekerja di luar negeri yang berterima baik secara teoritis maupun praktis. Untuk mencapai tujuan tersebut, penelitian ini dilaksanakan dalam tiga tahap selama 2 tahun dengan menggunakan desain penelitian pengembangan (research and development) sebagaimana dielaborasi oleh Borg & Gall (1982). Tahap penelitian meliputi: (1) tahap eksplorasi. Masalah yang hendak dijawab dalam tahap ini adalah: (a) bagaimana rekrutmen yang dilaksanakan PJTKI di wilayah kabupaten Malang; (b) bagaimana sistem layanan dan pengadministrasian terhadap tenaga kerja wanita di wilayah kabupaten Malang; (c) bagaimana sistem perlindungan bagi tenaga kerja

Edisi ke-27 Tahun 2008

135

wanita; dan (d) bagaimana peta kasus yang muncul pada tenaga kerja wanita di wilayah kabupaten Malang; (2) penelitian pengembangan. Masalah yang hendak dijawab dalam tahap ini adalah bagaimana mengembangkan prototype panduan bekerja bagi tenaga kerja wanita yang akan bekerja ke luar negeri yang berterima secara teoritis maupun praktis. Analisis data dilakukan dengan teknik analisis domain. Hasil penelitian menunjukkan: (1) bentuk rekrutmen tenaga kerja wanita yang dilakukan oleh PJTKI. Mantan TKW maupun calon TKW yang akan bekerja ke luar negeri banyak menggunakan jasa calo atau agen ke desa-desa yang menjadi sember penyedia TKW. Demikian juga kepengurusan surat-surat kelengkapan baik mantan TKW maupun calon TKW yang akan bekerja ke luar negeri banyak yang ditangani oleh calo. Bahkan semua urusan diserahkan ke PJTKI, mulai dari pengurusan dokumen jati diri, pemeriksaan kesehatan, pendidikan dan pelatihan, pengurusan paspor dan sebagainya; (2) Bentuk pengadministrasian suratsurat kelengkapan, penempatan, hak dan kewajiban serta surat perjanjian kerja. Berdasarkan temuan penelitian baik mantan TKW maupun calon TKW yang akan bekerja ke luar negeri tentang sertifikat kompetensi bekerja tidak ada sertifikat sedangkan pendidikan dan pelatihan diberikan surat keterangan lulus pelatihan. Tentang perjanjian penempatan sebagian mantan TKW maupun calon TKW ada yang tidak mengisi perjanjian penempatan, akan tetapi ada yang mengisi di tempatkan tidak sesuai perjanjian. Tentang perjanjian kontrak kerja baik manta TKW maupun calon TKW yang akan bekerja keluar negeri sebagian besar tidak mengerti isi maupun materinya, sebab biasanya kontrak kerja yang dituangkan dalam bahasa hukum, mengingat latar belakang pendidikan TKW Sekolah Dasar bahasa Indonesianya pas-pasan dan TKW banyak yang tidak memahami meskipun kontrak kerja ditanda tanganinya; (3) bentuk perlindungan selama bekerja di luar negeri. Pihak PJTKI pengirim memberikan perlindungan dalam bentuk kepengurusan asuransi, PJTKI tempat mengadu apabila TKW menemui masalah; dan (4) bentuk kasus yang ada menimpa para TKW: (a) masalah bahasa; (b) pendidikan dan pelatihan yang tidak sesuai dan tidak dapat diterapkan di negara penempatan; (c) naskah kontrak kerja yang sulit dipahami; (d) banyaknya praktik PJTKI ilegal; (e) perjanjian dalam pembayaran gaji tidak sesuai dengan perjanjian kerja; (f) kurang memahami materi pendidikan dan pelatihan; (g) masih adanya mantan TKW mendapat perlakuan kurang manusiawi; dan (h) belum ada perlindungan secara jelas oleh pihak PJTKI pengirim.

136 Abstrak Hasil Penelitian

133 Astawa, Ktut Diara; Hakim, Suparlan Al; Rochmadi, Nur Wahyu, 2007. Pengembangan Model Pembelajaran Keberagaman Budaya dalam Mata Pelajaran PKn dengan Pendekatan Multikultural untuk Meningkatkan Kecakapan Sosial Siswa SMK di Malang

Kata-kata kunci: model pembelajaran, materi keberagaman budaya

Realitas pembelajaran keberagaman budaya selama ini masih bersifat konvensional, sehingga siswa hanyaa tahu tentang keberagaman budaya dan belum bisa menerima dan menghargai perbedaan budaya. Perlu dikembangkan model pembelajaran materi keberagaman budaya dengan pendekatan multikultural. Model pembelajaran ini, tidak hanya meningkatkan kemampuan siswa membangun wawasan multikultural, tetapi menerima, dan menghormati keberagaman budaya. 134 Roekhan; Siswanto, Wahyudi; Muslich, Masnur. 2007. Model Pendidikan "Kecerdasan Ganda" di SMP melalui Pembelajaran Sastra

Kata-kata kunci: kecerdasan ganda, pendidikan kecerdasan ganda, pembelajaran sastra

Penelitian tentang model pendidikan kecerdasan ganda di SMP melalui pembelajaran sastra tahap pertama ini dimaksudkan untuk mendapatkan gambaran tentang kebutuhan guru bahasa Indonesia terhadap dan pelaksanaan pendidikan kecerdasan ganda melalui pembelajaran sastra. Hasil penelitian menunjukkan bahwa 100% guru membutuhkan pendidikan kecerdasan ganda melalui pembelajaran sastra, dengan rincian sebagai berikut: sangat tinggi untuk kecerdasan intrapersonal, tinggi untuk kecerdasan linguistik, matematis-logis, intrapersonal, dan rendah untuk kecerdasan irama-musik, visual-spasial, dan kinestetik. Juga diketahui bahwa 89,83% guru belum memahami konsep kecerdasan ganda dan pendidikan kecerdasan ganda. Akan tetapi, 32,08% guru sudah melaksanakannya melalui pembelajaran sastra. Kendati demikian masih terdapat 26,70% guru masih mengajarkan sastra dengan tekanan pengetahuan sastra dan 28,07% hanya menekankan pada pembinaan kemampuan apresiasi sastra. Untuk itu disarankan untuk segera disusun model pendidikan kecerdasan ganda melalui pembelajaran sastra, mensosialisasi-kan kepada mereka dan melatih mereka untuk menggunakannya di sekolah.

Edisi ke-27 Tahun 2008

137

135 Nasih, Ahmad Munjin; Ridwan, M. Dahlan; Amri, Misbahul M. 2007. Pengembangan Model Pendidikan Pencegahan Perceraian bagi Pasangan Suami Istri (Pasutri) Muslim

Kata-kata kunci: perceraian, korban peceraian, harmonis

Perceraian bagi setiap pasangan suami istri adalah sesuatu yang paling tidak diinginkan. Namun dalam realias di lapangan masih sering saja dijumpai ada pasangan yang memutuskan untuk bercerai, meskipun rumah tangga yang mereka bina telah berusia lebih dari 20 atau 30 tahun. "Luka" akibat perceraian tidak dipungkiri akan mewarnai perjalanan kehidupan mereka dan keluarganya setelah bercerai. Dan anak adalah korban terbesar dari perceraian yang dilakukan oleh ibu dan bapaknya. Perceraian sebenarnya dapat dihindari apabila suami atau istri mau mengkompromikan segala kepentingan yang mereka miliki untuk kepentingan bersama yang lebih besar, yakni keluarga harmonis. 136 Andaini, Susy Kuspambudi; Oktaviana, Lucky Tri; Yunus, Mahmuddin. 2007. Optimalisasi Penerapan E-learning dalam Komunitas dan Pembelajaran Matematika

Kata-kata kunci: e-Learning, pembelajaran Matematika, komunikasi

Strategi pembelajaran meliputi pengajaran, diskusi, membaca, penugasan. presentasi dan evaluasi. Secara umum keterlaksanaannya tergantung dari satu atau Iebih dari tiga dasar komunikasi: antara dosen dengan mahasiswa; antara mahasiswa dengan sumber belajar; antara mahasiswa dengan mahasiswa. Terselenggaranya ketiga jenis komunikasi merupukan syarat terselenggaranya dengan proses belajar mengajar. Apabila ketiga aspek tersebut bisa diselenggarakan dengan komposisi yang serasi, maka diharapkan akan terjadi proses pembelajaran yang optimal. Paradigma baru pembelajaran matematika menekankan pada: keterlerlibatan (partisipasi) optimal dari peserta didik, dan perluasan sumber belajar melaIui pemanfaatan perkmnbangan teknoIogi informasi. Kedua aspek semakin penting, tatkala outcomes pembelajaran diarahkan pada pencapaian kompetensi peserta didik. Pembelajarann e-learning menekankan pada kreatifitas peserta didik yang berpotensi mengembangkan kompetensinya, sehingga peserta didik akan lehib kompeten dalam menghadapi permasalahan pada kehidupan sehari-hari. Namun efektivitas hasil akan sangat dipengaruhi oleh banyak faktor, antara lain adalah

138 Abstrak Hasil Penelitian

ketersediaan fasilitas, dan kompetensi yang dimiliki oleh dosen. Berbekal pada hasil studi literatur pengumpulan data kebutuhan. dan faktor-faktor yang tepat mempengaruhi strategi e-learning (sebagai kekuatan, kelemahan, peluang atau ancaman), rnaka dikembagkan program e-learning dalam komunitas dan, pembelajaran Matematika. Program atau web site ini terdiri dari beberapa menu meliputi: Home, Dosen, lnformasi terbaru, forum Diskusi, e-learning, PMBK (Pembelajaran Matematika Berbantuan Komputer), Login Dilengkapi Juga untuk contact administrator Fasititas menu home, adalah tampilan utama pada saat web site ini pertama kali dijalankan pada alamat http://www.mat-um.org. pada menu home pengunjung web site dapat melihat secara umum tinjauan tentang Jurusan Matematika FMIPA UM dan gambaran tentang web site komunitas eLearning Jurusan Matematika FMIPA UM. Pada menu Dosen, pengunjung web site dapat berkonsultasi dengan Dosen di bidang pendidikan matematika, statistika, aljabar, geometri, matematika terapan, maupun komputasi. Pada menu informasi Terbaru, pengunjung dapat memperoleh informasi seputar matematika yang ditulis oleh Dosen Jurusan Matematika FMIPA UM. Pada menu Forum Komunikasi. Pengunjung dapat menyampaikan segala pemasalahan di bidang Matematika. PermasaIahan yang disampaikan oleh user akan ditanggapi oleh dosen yang kompeten di bidangnya. Pada menu PMBK, pengunjung web site dapat mengakses materi pembelajaran matematika berbantuan komputer. Pada menu Iogin, dibagi menjadi 3 bagian yaitu login untuk Administrator, login untuk dosen, dan login untuk User. Login untuk Administrator terdapat beberapa fasilitas antara lain: Entry Data Dosen, Entry Data User, Setup Web, Update informasi terbaru, Update forum Diskusi, Update Data e-Learning, Update Data PMBK. Login untuk dosen terdapat beberapa fasilitas antara lain: Update informasi terbaru, update forum diskusi, update data e-Iearning. Login untuk user terdapat beberapa fasiIitas antara lain mengisi data forum diskusi. 137 Nurhakiki, Rini; Andaini Susy Kuspambudi; Mahmuddin, Yunus. 2007. Pengembangan Model Pembelajaran Matematika pada Materi Dimensi Tiga melalui Pembelajaran Berbasis Komputer (PBK) untuk Meningkatkan Pemahaman Siswa SMA di Jawa Timur

Kata-kata kunci: dimensi 3, media Pembelajaran Berbasis Komputer

Edisi ke-27 Tahun 2008

139

Media pembelajaran dimensi 3 merupakan perangkat lunak Pembelajaran Berbasis Komputer (PBK) yang bertujuan untuk membantu siswa dalam memahami pelajaran matematika, khususnya materi dimensi 3 di SMA. Media Pembelajaran ini dirancang dengan menggunakan model tutorial, sehingga guru dapat memanfaatkan media ini dalam menyampaikan materi dimensi 3, dan siswa dapat menggunakan media ini dalam mempelajari dan memahami materi dimensi 3. 138 Yuwono, Ipung; Budiono, Edy; Hidayah, Indriati Nurul. 2007. Pengembangan Model Pembelajaran Matematika yang Sejalan dengan KBK 2006

Kata-kata kunci: model pembelajaran, matematika, kurikulum berbasis kompetensi, KTSP

Sampai saat ini hasil dan proses pembelajaran matematika di SMP masih jauh dari yang diharapkan. Pembelajaran matematika lebih banyak memberikan penekanan pada ketrampilan prosedural, kurang memberikan penekanan pada proses pemerolehan konsep oleh siswa. Tujuan penelitian ini adalah mengembangkan dan menghasilkan modl pembelajaran matematika di SMP yang valid, praktis dan efektif. Model KBK ini memberikan penekanan pada proses pemerolehan konsep oleh siswa.setelah konsep diperoleh siswa, siswa dilatih untuk menginternalisasi konsep tersebut. Jenis penelitian ini adalah penelitian pengembangan. Untuk mendapatkan model dan produk yang valid, praktis dan efektif, dilakukan pengembangan model dengan melewati validasi ahli, simulasi dan uji coba lapangan. Penelitian ini menghasilkan model pembelajaran yang dinamai model KBK. Model KBK yang dihasilkan telah memenuhi kriteria kevalidan, kepraktisan dan keefektifan. Berdasarkan hasil penelitian ini disarankan hal-hal sebagai berikut. (1) perlu pengembangan selanjutnya, yaitu pengembangan buku siswa dan buku guru yang sejalan dengan model KBK. Buku siswa dan buku guru diperlukan sebagai panduan implementasi Kurikulum 2006 untuk para guru matematika; (2) Kepala Sekolah dan pengurus MGAP (Musyawarah Guru Mata Pelajaran) Matematika hendaknya mendukung dan mengusahakan berbagai kegiatan formal untuk mensosialisasikan model KBK kepada guru matematika SMP; (3) para guru matematika hendaknya menggunakan model KBK sebagai salah satu pilihan dalam mengimplementasikan Kurikulum

140 Abstrak Hasil Penelitian

2006; dan (4) pengampu mata kuliah PBM di LPTK perlu memasukkan model KBK sebagai bagian isi dari kuliah PBM. 139 Mahanal, Susriyati; Fathurrachman; Saptasari, Murni. 2007. Pengembangan Perangkat Pembelajaran Deteksi Kualitas Sungai dengan Indikator Biologi Berbasis Konstruktivistik untuk Memberdayakan Sikap Siswa terhadap Ekosistem Sungai di Malang

Kata-kata kunci: indikator biologi, kualitas air, sungai Brantas, sungai Metro

Penelitian Pengembangan Perangkat Pembelajaran Deteksi Kualitas Sungai dengan Indikator Biologi Berbasis Konstruktivistik untuk Memberdayakan Sikap Siswa Terhadap Ekosistem Sungai di Malang ini dalam jangka panjang bertujuan meningkatkan kesadaran akan pentingnya kelestarian lingkungan hidup. Penelitian ini dilaksanakan dalam 3 tahap. Tahap1 Penelitian deskriptif eksploratif deteksi kualitas sungai dengan indikator biologi di penggalan sungai Brantas dan Metro. Penelitian tahap I dilaksanakan di penggalan sungai Kali Brantas dan sungai Metro Malang, Tujuan khusus penelitian tahap I adalah (1) mengidentifikasi spesies diatom perifiton yang berperan sebagai indikator biologi kualitas sungai dan (2) mengidentifikasi spesies makrobentos yang berperan sebagai indikator biologi kualitas sungai. Pengambilan sample di lapangan tanggal 10 Juni 2007 sampai dengan 9 September 2007. Pencuplikan diatom perifiton dilakukan lima kali dengan menggunakan substrat buatan berupa pelat kaca yang berukuran 3 15x10x0,5 Cm . Pelat kaca disusun vertikal pada bingkai pelat besi yang 3 berukuran 20x16x11 Cm , kemudian didedahkan pada lima stasiun di sungai Brantas dan sungai Metro selama 14 hari. Pengambilan saampel makrobenos dilakukan 5 kali di setiap stasiun pengamatan dengan menggunakan jala surber. Cuplikan diatom dan sample makrobentos yang diperoleh selanjut-nya di analisis di laboratorium Biologi Universitas Negri Malang. Hasil penelitian memperlihatkan bahwa: (1) ada perbedaan yang nyata kualitas air sungai berdasarkan parameter fisiko-kimia pada stasiun-stasiun pengamatan baik di sungai Kali Brantas maupun sungai Metro; (2) Achnanthes lanceolata adalah spesies indikator diatom perifiton untuk lingkungan yang belum tercemar; (3) Nitzchia palea merupakan spesies indikator diatom perifiton untuk lingkungan perairan yang sudah tercemar; dan (4) Chironomus merupakan spesies indikator dari makrobentos untuk lingkungan yang tercemar.

Edisi ke-27 Tahun 2008

141

140 Kustono, Djoko; Solichin; Martiningsih, Anny. 2007. Pengembangan Bahan Ajar Keselamatan dan Kesehatan Kerja (K3) Berorientasi Konstruktivistik Guna Menunjang Pelaksanaan KBK di Sekolah Menengah Kejuruan Teknologi

Kata-kata kunci: bahan ajar; K3; konstruktivistik; Sekolah Menengah Kejuruan

Bahan ajar Keselamatan dan Kesehatan Kerja (K3) berorientasi konstruktivistik guna menunjang pelaksanaan kbk di sekolah menengah kejuruan teknologi telah selesai dikembangkan. Bahan ajar ini terdiri dari (1) Buku Siswa; (2) Lembar Kegiatan Siswa dan (3) Buku Guru. Materi ajar terdiri dari enam modul yaitu (1) Undang-undang K3; (2) Mencegah dan Menanggulangi Kebakaran; (3) Bahan Beracun dan Berbahaya; (4) Mencegah Kecelakaan Kerja; (5) AlatPelindung Diri; dan (6) Pelindung Mesin. Penelitian ini termasuk penelitian pengembangan karena mengembangkan bahan ajar. Penelitian tahap pertama bertujuan untuk mendapatkan bahan ajar K3 yang valid menurut kriteria responden. Sedangkan penelitian Tahap 2 direncanakan uji coba di lapangan terkait dengan pembelajaran K3 di Sekolah Menengah Kejuruan Bidang Teknologi. Responden penelitian Tahap pertama adalah (1) kelompok guru pengajar K3 di SMK Teknologi; (2) kelompok dosen K3 di Universitas Negeri Malang; dan (3) kelompok pekerja di industri. Hasil penelitian tahap pertama menunjukkan (1) modul Undang-undang K3, mempunyai rerata validitas 83,6 %; (2) modul Mencegah dan Menanggulangi Kebakaran mempunyai rerata validitas 91,1 %; (3) modul Bahan Beracun dan Berbahaya mempunyai rerata validitas 89,5; (4) modul Mencegah Kecelakaan Kerja mempunyai rerata validitas 86,7; (5) modul Alat Pelindung Diri mempunyai rerata validitas 92,6; dan (6) modul Pelindung Mesin mempunyai rerata validitas 90,4%. Berdasarkan data tersebut maka dapat disimpulkan penelitian tahap pertama telah sukses dilakukan sehingga siap untuk dilakukan penelitian tahap dua. 141 Viani, Anti Asta; Adi, Eka Pramono. 2007. Pengembangan Model Pembelajaran Keterampilan Kejuruan Berbantuan Multimedia dan Berbasis Komunikasi Total Bagi Peserta Didik Penyandang Tunarungu Pasca Pendidikan Dasar

Kata-kata kunci: pengembangan model pembelajaran, multimedia, tunarungu, pendidikan dasar

142 Abstrak Hasil Penelitian

Penelitian ini dilakukan dengan tujuan untuk mendapatkan format model pembelajaran keterampilan kejuruan berbantuan multimedia dan berbasis komunikasi total yang teruji, sesuai dengan kebutuhan dan karakteristik peserta didik penyandang tunarungu di SLB/SMPLB di kota/ kabupaten Malang, Blitar, Pasuruan dan Probolinggo. Untuk itu dalam penelitian dilakukan melalui tahapan studi pendahuluan, pengembangan model hipotetik, pengembangan perangkat model (tahap I), dan eksperimentasi model (tahap II). Responden penelitian ini adalah guru keterampilan SMPLB di wilayah kota/kabupaten Malang, Blitar, Pasuruan dan probolinggo. Hasil penelitian ini dapat disimpulkan bahwa penelitian tahap pertama ini telah berhasil disusun perangkat model pembelajaran keterampilan kejuruan berbantuan multimedia dan berbasis komunikasi total yang sesuai dengan kebutuhan dan karakteristik peserta didik penyandang tunarungu pasca pendidikan dasar(SMPLB), dengan segala kelebihan dan kekurangannya. Secara khusus karakteristik spesifikasi perangkat pembelajaran keterampilan kejuruan berbantuan multimedia dan berbasis komunikasi total tersebut, sebagai berikut: (1) Hasil survey pendahuluan diketahui bahwa jenis keterampilan kejuruan yang paling banyak diajarkan pada anak tunarungu pasca pendidikan dasar di semua sekolah-sekolah penelitian adalah keterampilan kejuruan tata busana (menjahit); (2) Hasil observasi dan wawancara tentang materi pembelajaran keterampilan menjahit yang diajarkan pada anak tunarungu di sekolah-sekolah penelitian tersebut adalah materi belajar menjahit tingkat dasar; (3) Hasil analisis fisibilitas perangkat pembelajaran keterampilan menjahit yang layak dikembangkan dalam penelitian tahap pertama ini, meliputi: buku panduan guru dan visual compact disk (VCD) proses keterampilan menjahit tingkat dasar; dan (4) hasil uji validasi buku panduan dan perangkat media pembelajaran berupa VCD proses menjahit, menurut penilaian sebagian besar validator cukup memadai. Atas dasar itulah, bilamana hasil penelitian yang dicapai pada tahap pertama ini disetujui untuk dilanjutkan dengan ujicoba lapangan, disarankan kepada peneliti, antara lain: (1) mengemas materi buku panduan pembelajaran tersebut sebaik mungkin, baik dari tampilan fisik maupun isinya, termasuk revisi ilustrasi gambar yang disarankan; (2) melakukan sosialisasi dan persamaan persepsi terhadap strategi implementasi model pembelajaran yang telah disusun melalui diklat singkat yang melibatkan sekolah- sekolah penelitian; dan (3) melaksanakan eksperimentasi model pembelajaran keterampilan kejuruan menjahit yang disusun di sekolahsekolah penelitian yang ada di kota/kabupaten Malang, Blitar, Pasuruan dan Probolinggo yang dipilih secara purposif berdasarkan kriteria atau pertimbangan tertentu.

Edisi ke-27 Tahun 2008

143

142 Suparti, Rahayu P.W. 2007. Pengembangan Model Pendidikan Dan Pelatihan Kewirausahaan dalam Upaya Menciptakan Wirausaha Baru dari Kalangan Ibu-Ibu Rumah

Kata-kata kunci: indikator biologi, kualitas air, sungai Brantas, sungai Metro

Selama ini kegiatan Diklat Kewirausahaan yang pernah diikuti oleh ibuibu rumah tangga dalam rangka mengisi kegiatan PKK , hanya terbatas pada informasi tentang teori kewirausahaan tanpa ditindak lanjuti dengan kegiatan praktek di lapangan. Model diklat kewirausahaan tersebut kurang memberikan kontribusi terhadap peserta diklat, karena pengetahuan yang diperoleh hanya ditulis dalam buku catatan mereka tanpa ada kegiatan selanjutnya. Sedangkan model diklat kewirausahaan yang akan dikembangkan dalam penelitian ini adalah pemberian teori dan sekaligus praktek berwirausaha. Dengan adanya kegiatan konsultasi bisnis dan kegiatan pendampingan dalam model diklat ini, para peserta diklat yang ingin membuka usaha dapat memilih sesuai dengan bakat dan minat mereka . Sehingga bidang usaha yang mereka pilih bukan suatu kegiatan coba-coba, melainkan suatu rencana pendirian usaha yang sudah direncanakan dengan tepat dan dibawah bimbingan tenaga ahli sesuai dengan bidangnya . Sasaran penelitian tahun pertama adalah dihasilkannya panduan model diklat kewirausahaan yang dapat diImplementasikan dalam upaya menciptakan wirausaha baru. Rencana sasaran tahun Kedua adalah kegiatan pendampingan dan konsultasi bisnis dalam upaya menciptakan wirausaha baru mandiri. Penelitian ini termasuk Penelitian Tindakan (Action Research). Sedangkan bila dilihat dari tujuannya, penelitian ini termasuk penelitian pengembangan. Populasinya adalah ibu ­ ibu Rumah Tangga yang menjadi anggota PKK di wilayah Kecamatan Kedungkandang Kota Malang. Sampel dari penelitian ini adalah 20 orang ibu ­ ibu rumah tangga yang berasal dari 4 Kelurahan di wilayah Kecamatan Kedungkandang. Data dikumpulkan dengan dokumentasi dan observasi. Tekhnik analisis data menggunakan analisis deskriptif. Hasil penelitian tahap pertama ini adalah dihasilkannnya panduan model diklat kewirausahaan yang dapat diImplementasikan dalam upaya menciptakan wirausaha baru. Dihasilkannnya model diklat kewirausahaan ini dilakukan dengan kegiatan diklat , study banding dan seminar validasi hasil. Inovasi dari kegiatan penelitian ini adalah model diklat kewirausahaan yang berisi tentang teori kewirausahaan dan sekaligus praktek berwirausaha. adapun hasil produk sampingan dari kegiatan penelitian tahap pertama ini

144 Abstrak Hasil Penelitian

adalah dihasilkannya rencana bisnis dari peserta diklat kewirausahaan. Saran yang perlu disampaikan adalah mengujicobakan model diklat kewirausahaan hasil inovasi kedalam wilayah yang lebih luas dan jumlah peserta yang lebih banyak 143 Supriyono; Sutomo, Hedi; Hardika. 2007. Kebutuhan Akreditasi dan Sertifikasi Pendidikan Kesetaraan Program Paket C yang Berbasis Otonomi Daerah

Kata-kata kunci: pendidikan kesetaraan, ujian nasional pendidikan

Penelitian ini bertujuan mengetahui pola akreditasi dan sertifikasi hasil belajar yang terjadi pada pendidikan kesetaraan program Paket B. Penelitian dilakukan dengan studi kasus pada empat wilayah kabupaten/kota di Jawa Timur pada tahun 2006. Data dikumpulkan dengan wawancara dan studi dokumen, serta dilengkapi dengan observasi. Diperoleh temuan penelitian di mana belum ada akreditasi yang sistematis terhadap hasil belajar warga belajar sebelum menempuh ujian nasional sebagai bentuk sertifikasi pendidikan kesetaraan Paket C. Pada sisi lain muncul kebutuhkan terhadap model ujian daerah dan ujian praktek untuk mengaktualkan konsepsi/paradigma pendidikan berbasis luas, pendidikan berbasis masyarakat, pembelajaran kontekstual, dan program life skills. Dengan demikian sebaiknya ujian nasional bukan satu-satunya komponan yang menentukan kelulusan peserta ujian nasional pendidikan kesetaraan 144 Ramli, M; Irtadji; Utoyo, Sutoyo Imam. 2007. Pengembangan Model Bimbingan Peningkatan Kecerdasan Emosional Siswa Sekolah Menengah Atas dengan Pendekatan Pembelajaran Terstruktur

Kata-kata kunci: model bimbingan, pendekatan pembelajaran terstruktur, kecerdasan emosional, Siswa SMA

Penelitian ini dimaksudkan untuk mengembangkan model bimbingan dengan pendekatan pembelajaran terstruktur dan panduan pelaksanaannya dalam peningkatan kecerdasan emosional siswa Sekolah Menengah Atas (SMA) di Malang Raya yang berterima baik secara teoretis maupun praktis. Subjek uji produk adalah ahli bimbingan dan konseling sedangkan subjek sasaran adalah guru pembimbing dan siswa SMA di Malang Raya. Data dikumpulkan dengan menggunakan kuesioner penilaian dan inventori. Data dianalisis dengan menggunakan teknik analisis statistik deskriptif dan uji t.

Edisi ke-27 Tahun 2008

145

Hasil penelitian disimpulkan bahwa model bimbingan dengan pendekatan pembelajaran terstruktur dan panduan pelaksanaannya dalam peningkatkan kecerdasan emosional siswa SMA yang dikembangkan berterima baik secara teoretis maupun praktis. 145 Mu'arifin; Supriyadi; Surendra, Mulyani. 2007. Diseminasi dan Pengujian Ulang Tes Keterampilan Olahraga untuk Seleksi Penerimaan Mahasiswa Baru Jurusan Ilmu Keolahragaan

Kata-kata kunci: pengembangan, tes keterampilan olahraga

Pengembangan tes keterampilan olaharaga untuk seleksi penerimaan mahasiswa Jurusan Ilmu Keolahragaan telah dilaksanakan di Jawa Timur (UM dan Unesa). Untuk memperoleh bukti empiris tentang validitas dan reliabilitas tes pada kancah yang lebih luas, diperlukan pengujian ulang di Jawa Tengah (UNS, UNNES, dan UNY). Hasil yang diperoleh menunjukkan bahwa tes tersebut baik content validity maupun empirical validity terbukti teruji secara signifikan, sehingga semakin menguatkan tingkat kehandalannya sebagai tes yang bisa digunakan untuk keperluan seleksi mahasiswa terkait. 146 Hasanah, Muakibatul; Nurchasanah. 2007. Pengembangan Majalah Anak untuk Meningkatkan Kompetensi Membaca, Menulis, dan Berhitung (Calistung) Anak Usia Prasekolah

Kata-kata kunci: kompetensi, membaca, menulis, dan berhitung

Peningkatan kualitas pembelajaran menjadi target di setiap lembaga pendidikan, termasuk di TK (Taman Kanak-kanak). Untuk kepentingan itu, mereka memanfaatkan majalah sebagai media pembelajaran. Karena itu, pengembangan majalah anak merupakan langkah yang tepat dan ini sudah dilakukan pada tahap I. Pada tahap II, majalah yang sudah dikembangkan diujicobakan di lapangan dengan desain tindakan kelas dan hasilnya membuktikan bahwa majalah tersebut dapat meningkatkan kompetensi Calistung dan minat belajar anak prasekolah. 147 Iriaji; Towaf, Siti Malikah; Herawati, Ida Siti. 2007. Pengembangan Gambar Illustrasi Berperspektif Jender pada Buku Teks Sekolah

146 Abstrak Hasil Penelitian

Dasar Kelas Awal (Pengembangan Draf Buku Panduan dan Draf CD Interaktif Panduan)

Kata-kata kunci: gambar illustrasi, perspektif jender, buku teks, sekolah dasar

Hasil penelitian tahun pertama menggambarkan bahwa buku teks SD kelas awal masih banyak yang bisa gender. Hal ini akan membentuk individu si pembelajar dangan kualitas sikap mental yang bias gender. Disamping itu juga ditemukan bahwa gambar ilustrasi yang adda pada buku teks SD kelas awal masih kurang mempertimbangkan aspek penataan artistik dan tipologi gambar. Karena itu, perlu dikembangkan panduan pembuatan gambar ilustrasi pada buku teks SD kelas awal yang berspektif gender, berpenataan artistik dan bertipologi gambar sesuai tingkat umur siswa. Melalui pengembangan panduan pembuatan gambar ilustrasi yang memuat wawasan konsep, dasar pemikiran, dan cara pembuatan gambar ilustrasi berspektif gender, berpenataan artistik dan bertipologi gambar sesuai tingkat umur siswa diharapkan dapat membantu mewujudkan gambar ilustrasi pada buku teks SD kelas awal sebagaimana dimaksud sehingga bisa menjadi sarana pembelajaran yang efektif untuk membentuk sikap mental pembelajar yang menghargai kesetaraan dan keadilan gender. Tujuan penelitian pengembangan tahun kedua adalah untuk menghasilkan draf final panduan pembuatan gambar ilustrasi dalam bentuk buku dan CD interaktif yang teruji kelayakannya dapat digunakan ilustrator dalam mengembangkan gambar ilustrasi buku teks SD kelas awal. Rancangan penelitian ini menggunakan rancangan penelitian pengembangan model prosedural. Model proseduran yang dipilih mengdaptasi model penelitian dan pengembangan (research and development/R&D) yang dikembangkan Borg dan Gall (1983) dan rancangan procedural yang dikembangkan oleh McKenny (2001). Ada tiga langkah tahap penelitian, yaitu meliputi: (1) tahap studi pendahuluan sebagai needs and contens analysis, (2) tahap pengembanggan sebagai design, development and evaluation stages, dan (3) tahap pengujian efektifitas produk sebagai semisumative evaluation. Penelitian tahun kedua merupakan penerapan tahap pengembangan design, development, and evaluation stages. Langkah-langkah meliputi: (1) evaluasi oleh tim peneliti melibatkan 4 ahli, (2) evaluasi oleh illustrator dan penulis buku teks melibatkan 4 orang, (3) evaluasi aspek isi oleh ahli isi melibatkan 3 orang (ahli kajian gender,ahli teknologi pembelajaran dan ahli bahasa) dan evaluasi aspek fisik oleh ahli desain melibatkan 2 orang, dan (4) uki coba lapangan terbatas melibatkan 1 orang illustrator.

Edisi ke-27 Tahun 2008

147

Instrumen yang digunakan untuk mengumpulkan data berupa angket terbuka, angket skala likert, dan format catatan diskusi terfokus. Data hasil evaluasi maelalui angket skala likert akan dianalisis menggunakan teknik analisis rata-rata. Sedangkan data hasil angket terbuka dan rekama diskusi terfokus akan dianalisis dengan teknik analisis deskriptif kualitatif. Hasil penelitian menunjukkan, bahwa berdasarkan hasil uji/evaluasi oleh ilustrator dan penulis buku teks diperoleh gambaran bahwa dari aspek isi perspektif gender buku panduan yang dikembangkan dinilai baik (rata-rata skor 3,40), sedangkan dari aspek fisik dinilai cukup baik (rata-rata slor 2,90). Hasil uji/evaluasi oleh ahli kajian gender, ahli pembelajaran, dan ahli bahasa diperoleh gambaran bahwa aspek isi buku panduan yang dikembangkan dinilai baik (rata-rata skor 3,60). Ahli Desain Grafis menilai buku panduan yang dikembangkan dari aspek fisik baik (rata-rata skor 3,29). Berkaitan dengan CD Interaktif panduan dinilai oleh ahli Desain Grafis cukup baik (rata-rata skor 2,64). Hasil uji coba terbatas terhadap penggunaan panduan dapat digambarkan bahwa rerata skor nilai sesudah menggunakan draf panduan jauh lebih tinggi (3,45) dibanding dengan rerata skor (2,21) sebelum menggunakan draf panduan. Tanggapan ilustrator dan penulis buku teks sesudah mengamati penggunaan draf panduan rata-rata frekuensi 3,8 atau 95% untuk jawaban ya dapat digunakan. Hal ini membuktikan bahwa secara kelayakan praktis dan kelayakan produk pada tingkat terbatas sudah memenuhi syarat untuk bisa digunakan. Revisi draf panduan dilaksanakan 3 kali revisi setelah mendapat saran masukan dan komentar dari evaluator, yaitu: (1) revisi I dilakukan setelah uji/evaluasi oleh ilustrator dan penulis buku teks dan (2) revisi II dilakuka setelah uji/evaluasi oleh para ahli, dan revisi III dilakukan setelah uji coba lapangan terbatas. Secara garis besar hasil revisi meliputi, pertama dari aspek isi: (1) menggunakan bahasa yang lebih sederhana, tidak terlalu panjang dan sistematis; (2) mengurangi penggunaan istilah asing; (3) menambahkan tim penulis pada sampul; dan (4) menambah teks ucapan terima kasih pada sambutan dan kata pengantar. Kedua revisi fisik meliputi aspekpenataan artistik dan aspek tipologi gambar. Revisi aspek penataan artistik meliputi: (1) agar lay out sampul panduan menarik logo UM diperkecil dan gambar sampul dipilih satu gambar yang mewakili content; (2) agar lay out pada kata pengantar dan sambutan menarik spasi dirapatkan dan hiasan atas diperkecil sesuai proporsi; (3) even page header berupa gambar bagian atas perlu dibuat yang tidak bias gender (misalnya ibu menyuapi tambahkan bapak membantu; dan (4) penataan gambar kasus dan solusi didekatkan sehingga mudah diamati. Sedangkan dari aspek tipologi gambar tidak ada saran masukan maupun komentar. Ketiga revisi CD Interaktif, meliputi: (1)

148 Abstrak Hasil Penelitian

desain tampilan muka dan ukuran teks dan gambar ditata ulang agar tidak terkesan kosong, warna lebih kontras dan menarik; (2) tombol toll dibuat lebih menarik dan jelas keterangannya; (3) gambar animasi diganti agar tidak terlalu dominan wanita; dan (4) gambar maupun warna antar desain tampilan muka dibuat berbeda agar mudah terbaca. Draf produk panduan ini perlu ditindak lanjuti pengembangannya dengan berbagai kegiatan sebagai berikut: (a) draf panduan masih sampai pada tahap uji coba terbatas, sehingga belum bisa diketahui tingkat kelayakan praktis dan kelayakan produk secara nyata di lapangan, oleh karena itu disarankan untuk bisa ditindak lanjuti melalui uji coba lapangan yang lebih luas yang melibatkan para ilustrator,penulis buku teks, editor, dan penata letak dari berbagai penerbit dan (b) hasil pengembangan gambar ilustrasi buku teks SD kelas awal yang dibuat ilustator berdasarkan panduan tersebut dapat ditindak lanjuti dengan penelaahan tim ahli sebagai dasar perbaikan atau revisi sehingga diperoleh prototype buku teks SD kelas awal yang sudah berperspektif gender, berpenataan artistik, dan bertipologi gambar sesuai tingkat umur anak. 148 Purwaningsih, Endang; Dasna, I Wayan; Kartini, Endang. 2007. Pengembangan Bahan Ajar Sains SMP Berorientasi Konstrukvitasi untuk Menunjang Implementasi Kurikulum Berbasis Kompetensi

Kata-kata kunci: indikator biologi, kualitas air, sungai Brantas, sungai Metro

Produk akhir Penelitian dan Pengembangan ini adalah dihasilkannya bahan ajar bagi siswa dan guru. Bahan ajar bagi siswa dinamakan Buku Siswa merupakan kumpulan modul, setiap modul berisi satu pokok bahasan. Modul disusun dengan langkah-langkah mengikuti model siklus belajar. Bahan ajar bagi guru dinamakan Buku Guru yang berisi pengembangan silabus, RPP, pengembangan materi dan kunci jawaban. Latar belakang bahan ajar ini disusun, karena berdasarkan hasil penelitian Purwaningsih (2002), pada saat guru melakukan inovasi pembelajaran yaitu dengan menggunakan model siklus belajar, siswa pasif dan untuk melaksanakan pembelajaran memerlukan waktu yang lebih lama dari alokasi waktu yang ditentukan. Harapannya Buku Siswa tersebut dapat digunakan oleh siswa sebagai persiapan dan bekal untuk mengikuti pembelajaran sains di sekolah dan untuk melatih serta mempersiapkan siswa belajar mandiri. Tiap modul disusun berorientasi pada pendekatan konstruktivistik, dengan model siklus belajar. Modul ini tidak hanya berisi

Edisi ke-27 Tahun 2008

149

informasi tentang materi tetapi penyajiannya berupa langkah-langkah yang menuntun siswa menemukan konsep. Harapannya, dengan mengikuti langkah-langkah pada modul ini siswa tidak lagi pasif tetapi menjadi aktif dan kreatif. Buku Siswa diharapkan juga dapat membantu guru mengefektifkan dan mengefisiensikan proses pembelajaran sehingga kekurangan waktu yang dikeluhkan oleh guru selama ini dapat teratasi. Buku Guru disusun dengan harapan dapat membantu guru dalam menerapkan pembelajaran yang konstruktivistik, dengan model siklus belajar. Penelitian dan Pengembangan ini dilakukan dalam tiga tahap kegiatan selama 3 tahun. Tahun pertama telah dikembangkan desain model pengembangan bahan ajar untuk siswa berupa modul tersebut. Desain model pengembangan modul pada tahun pertama telah diterapkan pada beberapa materi klas VII. Hasil pengembangan modul telah dievaluasi oleh ahli yaitu dosen yang kompeten dengan materi dan proses pembelajaran dan guru bidang studi yang kompeten. Pada tahun kedua modul tersebut diujicobakan secara terbatas yaitu pada beberapa siswa yang sudah pernah mempelajari materi tersebut dari buku lain dan siswa yang belum pernah mempelajari. Pada siswa yang sudah pernah mempelajari materi yang diujicobakan diharapkan dapat memberikan komentar tentang isi dan cara penyajian dibandingkan dengan isi buku yang pernah dipelajari. Hasil uji coba terbatas ini digunakan untuk memperbaiki modul baik materi, bahasa, dan kemenarikan penyajiannya. Setelah direvisi dilakukan ujicoba secara lebih luas yaitu diujicobakan diklas nyata di beberapa sekolah. Ujicoba lebih luas ini dimaksudkan untuk melihat keterlaksanaan penggunaan modul dalam pembelajaran, efektifitas dan efisiensi dalam penggunaan waktu, keterbacaan, tingkat kesulitan. Beberapa materi dilaksanakan dengan menggunakan model penelitian tindakan kelas dengan harapan dapat melihat apakah ada peningkatan dalam motivasi, prestasi dan kinerja siswa selama dua siklus pembelajaran. Pada akhir tahun kedua pengembangan model sudah sesuai dengan yang diharapkan ditinjau dari keterlaksanaan, kemenarikan, ketercapaian kompetensi (keefektifan), efisien dalam penggunaan waktu dan kecilnya tingkat kesulitan yang dihadapi siswa dalam menggunakan modul. Pada tahun ketiga ini dilakukan pengujian model untuk melihat keampuhan dan keefektivan model dengan menggunakan dengan menggunakan penelitian kuasi-eksperimen. Desain kuasi-eksperimen yang dipilih adalah kelompok kontrol prates-pascates berpasangan (The Matching Pretest-Posttest Control Group Design). Modul yang diuji adalah satu pokok bahasan biologi, satu pokok bahasan kimia dan dua pokok bahasan fisika. Keempat modul diujikan pada siswa SMP yang berbeda. Berdasarkan

150 Abstrak Hasil Penelitian

perhitungan statistik telah diperoleh bahwa uji prasyarat normalitas dan homogenitas dipenuhi sehingga uji hipotesisnya menggunakan uji t. Pengolahan data menggunakan software SPSS versi 12. Hasil uji hipotesis menunjukkan bahwa ada perbedaan prestasi belajar antara siswa yang mengikuti pembelajaran menggunakan modul dengan siswa yang mengikuti pembelajaran dengan menggunakan buku lain. Dapat ditunjukkan pula bahwa terjadi peningkatan prestasi yang lebih tinggi pada klas eksperimen dibandingkan pada klas kontrol. Ini menunjukkan bahwa peningkatan prestasi siswa yang menggunakan modul lebih tinggi daripada siswa yang tidak menggunakan modul. 149 Rahayu, Sri; Setyosari, Punadji; Prayitno. 2007. Pengembangan Perangkat Pembelajaran Kimia SMA Berbasis Student Focused Active Learning (SFAL) untuk Menunjang Implementasi Kurikulum Berbasis Kompetensi

Kata-kata kunci: pembelajaran Kimia SMA, Student Focused Active Learning, kurikulum berbasis kompetensi

Paradigma pembelajaran dalam kurikulum baru sekolah menengah berbeda dari kurikulum sebelumnya, yaitu menganut paradigma konstruktivisme dengan ciri pembelajaran yang student-centered. Dalam kurikulum baru tersebut, guru diberi keleluasan untuk berkreasi dalam mengimplementasikan kurikulum, karena itu dalam kurikulum baru hanya memuat ramburambu dan standar minimal yang perlu dicapai. Dalam satu sisi kurikulum tersebut memberi kebebasan guru untuk menunjukkan kreativitasnya, namun disisi lain juga tidak mudah bagi guru untuk menterjemahkan keinginan kurikulum. Dalam hal kurikulum Sains SMA termasuk kimia, sebagian besar guru merasa kesulitan dalam mengimplementasikan KBK sesuai dengan tuntutan kurikulum, oleh karena itu perlu diupayakan suatu usaha untuk membantu para guru tersebut. Tujuan penelitian ini adalah mengembangkan prototipe Model Pembelajaran Student-Focused Active Learning (SFAL) beserta perangkat pembelajarannya yang berorientasi konstruktivistik, inkuiri dan kontekstual dalam rangka membantu guru kimia dalam mengimplementasi kurikulum. Penelitian pengembangan ini dilaksanakan selama 3 tahun/tahap. Dalam tahun pertama dikembangkan prototipe mMdel SFAL dan perangkatnya, tahun kedua melihat efektivitas model SFAL beserta perangkatnya dan tahun ke-3 adalah evaluasi/uji efektivitas dan diseminasi model SFAL dalam setting riil di sekolah dengan cara Lesson Study. Luaran yang dihasilkan

Edisi ke-27 Tahun 2008

151

pada tahun pertama adalah prototipe Model Pembelajaran SFAL dan perangkat pembelajaran yang layak untuk diimplementasi di sekolah. Luaran tahun kedua adalah model pembelajaran SFAL dan perangkatnya yang efektif diterapkan di sekolah dalam seting yang ideal. Luaran tahun ketiga adalah model SFAL yang benar-benar efektif diterapkan sesuai dengan kondisi sekolah dan kharakteristik siswa yang beragam. Hasil penelitian tahun kedua adalah (1) ada perbedaan prestasi belajar yang signifikan antara siswa yang diajar dengan model pembelajaran SFAL dengan siswa yang diajar dengan model pembelajaran konvensional. Pemberian perlakuan model pembelajaran SFAL memberikan pengaruh yang signifikan terhadap prestasi belajar, khususnya di SMA yang siswanya memiliki kharakteristik berkemampuan akademik baik; (2) tidak ada perbedaan prestasi belajar yang signifikan antara siswa yang diajar dengan model pembelajaran SFAL dengan siswa yang diajar dengan model pembelajaran konvensional. Pemberian perlakuan model pembelajaran SFAL tidak memberikan pengaruh yang signifikan terhadap prestasi belajar, khususnya di SMA yang siswanya memiliki kharakteristik berkemampuan akademik rendah/bawah; (3) di SMA yang siswanya memiliki kharakteristik berkemampuan akademik baik, sikap siswa terhadap kimia yang diajar dengan model pembelajaran SFAL lebih positif daripada sikap siswa yang diajar dengan model pembelajaran konvensional; dan (4) di SMA yang siswanya memiliki kharakteristik berkemampuan akademik rendah/bawah, sikap siswa yang diajar dengan model pembelajaran SFAL hampir sama dengan sikap siswa yang diajar dengan model pembelajaran konvensional. Oleh karena hasil penelitian tahun kedua ini memberikan pengaruh yang berbeda-beda terhadap prestasi belajar dan sikap siswa terhadap kimia, maka masih sangat diperlukan adanya uji efektivitas dalam kondisi riil di lapangan untuk melihat efektifitasnya dan sekaligus mendeseminasikan hasil penelitian ini untuk guru-guru kimia SMA. Bersama guru-guru SMA di sekolah yang kharakteristik siswanya berbeda-beda, efektifitas model pembelajaran yang dikembangkan ini perlu diuji kembali agar dapat diimplementasikan secara nyata oleh guru-guru kimia sesuai dengan kharakteristik siswanya, namun tanpa mengabaikan kaidah-kaidah yang diterapkan dalam Model pembelajaran SFAL. Cara yang cocok untuk melaksanakan uji efektifitas Model SFAL yang riil di lapangan adalah dengan cara lesson study. 150 Rahayu, P. W.; Sudarmiatin. 2007. Pengembangan Penyusunan Modul dalam Rangka Implementasi Kurikulum SMK (SMEA) Berbasis Kompetensi

152 Abstrak Hasil Penelitian Kata-kata kunci: penyusunan modul, SMK, kurikulum berbasis kompetensi

Kurikulum Berbasis Kompetensi edisi 2004 mengalami perkembangan yang disebut dengan Kurikulum Tingkat Satuan Pendidikan (KTSP) edisi 2006. Walaupun kedua kurikulum (KBK 2004 dan KTSP 2006) tersebut berganti nama, namun keduanya masih dalam koridor Kurikulum Berbasis Kompetensi. KBK 2004 yang dipathok adalah kompetensinya sedangkan Kurikulum Tingkat Satuan Pendidikan edisi 2006 yang dipathok adalah Standar Kelulusan (SKL) dan Kompetensi Dasar (KD), dan sekolah diberi kewenangan untuk mengembangkan materinya. Salah satu ciri Kurikulum Berbasis Kompetensi adalah pembelajaran modular. Selama ini sistematika penulisan modul yang disampaikan Dikmenjur melalui KBK 2004 sangat rumit. Hal ini dibuktikan dengan adanya berbagai kendala penyusunan modul di lapangan, antara lain (1) terbatasnya referensi; (2) rendahnya penguasaan guru terhadap teknologi; (3) terbatasnya sarana dan prasarana penunjang; (4) rendahnya pemahaman guru terhadap pentingnya penyusunan modul; (5) rendahnya daya beli siswa dalam membeli modul; dan (6) adanya persepsi yang berbeda dari para guru tentang KBK 2004. Sebagai akibat dari adanya berbagai kendala tersebut akhirnya banyak guru yang mengambil jalan pintas dengan cara membeli modul dari berbagai penerbit. Padahal modul yang dibeli tersebut kurang mengacu pada tuntutan KBK 2004 misalnya tidak mencantumkan panduan guru ataupun siswa, tidak ada daftar pustaka, tidak menyebutkan kompetensi/sub kompetensi yang akan diukur, dan lain-lain. Untuk itu peneliti bermaksud memberikan solusi berupa sistematika modul yang lebih sederhana, tetapi tetap mengacu pada sistematika modul KBK 2004 dari Dikmenjur. Modul ini diharapkan dapat lebih aplikatif, valid, efektif dan efisien. Untuk mencapai standar kriteria tersebut dilakukan validasi, simulasi dan uji coba modul di sekolah (SMEA). Pada penelitian Tahap Pertama (Tahun I) telah dihasilkan modul dan panduan pembelajaran kewirausahaan kelas I, II, III yang disusun oleh guruguru kewirausahaan Se-kota dan Kabupaten Malang dan telah divalidasi oleh pihak-pihak terkait, yaitu: DUDI, pakar kewirausahaan, guru kewirausahaan, dan wakasek kurikulum SMEA. Pada penelitian Tahap Kedua (Tahun II) telah dilakukan ujicoba modul dan panduan pembelajaran kewirausahaan kelas I, II ke 4 SMEA, yaitu dua SMEA negeri dan dua SMEA swasta di kota dan Kab. Malang. Hal ini bertujuan agar modul dan panduan pembelajaran kewirausahaan bisa diaplikasikan di sekolah. Sehingga beberapa kelemahan dan kekurangan yang ada dapat dipakai sebagai masukan untuk merevisi modul dan panduan pembelajaran kewirausahaan. Pada penelitian Tahun II ini dihasil-

Edisi ke-27 Tahun 2008

153

kan modul dan panduan pembelajaran kewirausahaan kelas I, II yang layak dan aplicable (siap pakai). Rencana Penelitian pada Tahap Ketiga (Tahun III) kegiatan difokuskan pada pengurusan pendaftaran paten, menyusun proposal pendaftaran paten, penggandaan modul dan panduan pembelajaran kewirausahaan dan sosialisasi modul ke SMEA se-kota dan Kabupaten Malang. Menurut metodenya, penelitian ini termasuk dalam penelitian deskriptif. Sedangkan menurut tujuannya termasuk dalam penelitian pengembangan. Variabel penelitian adalah (1) proses pendaftaran modul dan panduan pembelajaran kewirausahaan kelas I, II ke Direktorat Jenderal Paten; (2) penggandaan modul dan panduan pembelajaran kewirausahaan kelas I, II; dan (3) sosialisasi modul dan panduan pembelajaran kewirausahaan kelas I, II. Metode pengumpulan data menggunakan wawancara, dokumentasi. Teknik analisis datanya adalah deskriptif kualitatif.

154 Abstrak Hasil Penelitian

Edisi ke-27 Tahun 2008

155

156 Abstrak Hasil Penelitian

Edisi ke-27 Tahun 2008

157

158 Abstrak Hasil Penelitian

Edisi ke-27 Tahun 2008

159

160 Abstrak Hasil Penelitian

Edisi ke-27 Tahun 2008

161

162 Abstrak Hasil Penelitian

Edisi ke-27 Tahun 2008

163

164 Abstrak Hasil Penelitian

Edisi ke-27 Tahun 2008

165

166 Abstrak Hasil Penelitian

Information

042

166 pages

Report File (DMCA)

Our content is added by our users. We aim to remove reported files within 1 working day. Please use this link to notify us:

Report this file as copyright or inappropriate

406916

Notice: fwrite(): send of 197 bytes failed with errno=104 Connection reset by peer in /home/readbag.com/web/sphinxapi.php on line 531