Read DNA_Sentences.pdf text version

NAME_____________________________ CLASS_____________________________ HOW TO UNDERSTAND DNA WITHOUT REALLY TRYING

Below are t-RNA codons for several t-RNA triplets. Instead of amino acids, words have been substituted so that when you decode the DNA you will produce a sentence instead of a protein. Write the m-RNA sequence and the t-RNA sequence for each of the following DNA molecules, and then substitute the "amino acid" words to make a "protein" sentence.Then write your own DNA molecule and ask your lab partner to decode it. t-RNA anticodons acid" AGA UGU GUA AAA CGG AGU GAG GCU AAC AUG "amino acid" I more study went love go will DNA code fun t-RNA anticodons CCG UUU GGU CUG UAG AAU GUG GCG CAC GUU "amino

to biology student ought today am is class genetics often

1. DNA m-RNA t-RNA "protein" 2. DNA m-RNA t-RNA "protein"

AGACGGTTT UCUGCCAAA AGA CGG UUU I Love Biology

AGACTGCCGGTATTTTGT

3. DNA m-RNA t-RNA "protein

AGAGAGAGTCCGTTTTAG

4. DNA m-RNA t-RNA "protein" 5. DNA m-RNA t-RNA "protein" 6. DNA m-RNA t-RNA "protein"

AGAGAGAGTCCGGCGCCGGTATTTTAG

TTTGTGGTTATG

AGAAATATGTAG

Information

2 pages

Find more like this

Report File (DMCA)

Our content is added by our users. We aim to remove reported files within 1 working day. Please use this link to notify us:

Report this file as copyright or inappropriate

1187036


You might also be interested in

BETA
MICROBIOLOGY/GENETICS 607