Read Evaluation of RGS4 as a candidate gene for schizophrenia text version

American Journal of Medical Genetics Part B (Neuropsychiatric Genetics) 141B:418 ­420 (2006)

Brief Research Communication Evaluation of RGS4 As a Candidate Gene for Schizophrenia

Yu-Li Liu,1 Cathy Shen-Jang Fann,2 Chih-Min Liu,1 Jer-Yuarn Wu,3 Shuen-Iu Hung,3 Hung-Yu Chan,4 Jiahn-Jyh Chen,4 Chin-Yu Lin,2 Shih-Kai Liu,1 Ming H. Hsieh,1 Tzung-Jeng Hwang,1 Wen-Chen OuYang,4,5 Chun-Ying Chen,6 Jin-Jia Lin,7 Frank Huang-Chih Chou,8 Ching-Mo Chueh,9 Wei-Ming Liu,10 Ming-Min Tsuang,11 Stephen V. Faraone,12 Ming T. Tsuang,13 Wei J. Chen,14 and Hai-Gwo Hwu1,14,15*

1 Department of Psychiatry, National Taiwan University Hospital and National Taiwan University College of Medicine, Taipei, Taiwan 2 Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan 3 National Genotyping Center, Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan 4 Taoyuan Psychiatric Center, Taoyuan, Taiwan 5 Chia-Nan Psychiatric Center, Tainan, Taiwan 6 Tsaotun Psychiatirc Center, Tsaotun, Taiwan 7 Department of Psychiatry, Chimei Medical Center, Tainan, Taiwan 8 Kai-Suan Psychiatric Hospital, Kaohsiung City, Taiwan 9 Yuli Veterans Hospital, Yuli, Taiwan 10 Yuli Hospital, Yuli, Taiwan 11 Ju-Shan Mental Hospital, Taoyuan, Taiwan 12 Medical Genetic Research, Child and Adolescent Psychiatric Research, SUNY Upsate Medical University 13 Harvard Institute of Psychiatric Epidemiology and Genetics, and Departments of Epidemiology and Psychiatry, Harvard University, Boston, Massachusetts and Institute of Behavioral Genomics, University of California, San Diego, California 14 Institute of Epidemiology, College of Public Health, National Taiwan University, Taipei, Taiwan 15 Department of Psychology, College of Science, National Taiwan University, Taipei, Taiwan

Several studies have suggested that the regulator of G-protein signaling 4 (RGS4) may be a positional and functional candidate gene for schizophrenia. Three single nucleotide polymorphisms (SNP) located at the promoter region (SNP4 and SNP7) and the intron 1 (SNP18) of RGS4 have been verified in different ethnic groups. Positive results have been reported in these SNPs with different numbers of SNP combinatory haplotypes. In this study, these three SNP markers were genotyped in 218 schizophrenia pedigrees of Taiwan (864 individuals) for association analysis. Among these three SNPs, neither SNP4, SNP7, SNP18 has shown significant association with schizophrenia in single locus association analysis, nor any compositions of the three SNP haplotypes has shown significantly associations with the DSM-IV diagnosed schizophrenia. Our results fail to support the RGS4 as a candidate gene for schizophrenia when evaluated from these three SNP markers. ß 2006 Wiley-Liss, Inc.

KEY WORDS:

schizophrenia; RGS4; G-protein; haplotype; SNP; Taiwan families

Please cite this article as follows: Liu Y-L, Shen-Jang Fann C, Liu C-M, Wu J-Y, Hung S-I, Chan H-Y, Chen J-J, Lin C-Y, Liu S-K, Hsieh MH, Hwang T-J, OuYang W-C, Chen C-Y, Lin J-J, Chou FH-C, Chueh C-M, Liu W-M, Tsuang M-M, Faraone SV, Tsuang MT, Chen WJ, Hwu H-G. 2006. Evaluation of RGS4 As a Candidate Gene for Schizophrenia. Am J Med Genet Part B 141B:418­420. Regulator of G-protein signaling (RGS) is a family of proteins modulating the G-protein signaling pathways [Hollinger and Hepler, 2002; Ishii and Kurachi, 2003]. RGS proteins have one major role as GTPase-activating proteins (GAP), which accelerate Ga-catalyzed GTP hydrolysis and shorten the G protein mediated intracellular signaling [Dohlman and Thorner, 1997]. There are at least 20 RGS family members identified; the subtypes expressed in human brain include RGS4, RGS7, RGS8, RGS11, and RGS17 [Erdely et al., 2004; Larminie et al., 2004]. The roles of RGS proteins in the central nervous system have not been extensively characterized, the RGS4 gene has been suggested as a candidate gene for schizophrenia [Chowdari et al., 2002]. RGS4 has been supported as a candidate gene in schizophrenia by several studies. RGS4 expression was decreased across the cerebral cortex of patients in microarray analysis [Mirnics et al., 2001a,b]. RGS4 regulated the G-protein signaling pathways relevant to several schizophrenia-associated receptors such as dopamine and glutamate receptors [Saugstad et al., 1998; Taymans et al., 2003, 2004]. RGS4 had a genomic position close to 1q21­q22, which had previously been implicated in schizophrenia by linkage studies [Brzustowicz et al., 2002; Hwu et al., 2003; Owen et al., 2004]. Furthermore, two proband-parent trio samples from the US, and from India, and a third small sample recruited by the NIMH Collaborative

Grant sponsor: National Science Council, Taiwan; Grant numbers: NSC-91-3112-B-002-011, NSC-92-3112-B-002-019, NSC-93-3112-B-002-012, NSC-94-3112-B-002-020; Grant sponsor: National Health Research Institute, Taiwan; Grant numbers: NHRI-90-8825PP, NHRI-EX91, 92, 93-9113PP, IRO1 MH5962401. *Correspondence to: Hai-Gwo Hwu, Department of Psychiatry, National Taiwan University Hospital, No. 7, Chung San South Road, Taipei, Taiwan, 100. E-mail: [email protected] Received 12 August 2005; Accepted 28 December 2005 DOI 10.1002/ajmg.b.30286

ß 2006 Wiley-Liss, Inc.

RGS4 and Schizophrenia TABLE I. PCR Primer and Probe Sequences Designed for Each SNP of RGS4 SNP ID SNP1 SNP 4 rs951436 SNP 7 rs951439 SNP18 rs2661319 Allele type G/A A/C G/A A/G PCR primers and probe sequences (50 ­30 end) Forward: ACGTTGGATGTGACCTCTAGTTTTGTAACG Reverse: ACGTTGGATGACCAGAATGTTATGCTAAGG Probe: GTTTTGTAACGTGCCCTG Forward: ACGTTGGATGGGCCTAGACATCAATGAGAG Reverse: ACGTTGGATGTGGTATACAGCATCCTCCAG Probe: CAATGAGAGTTCAGTTATTGA Forward: ACGTTGGATGCATCTGGAAGGTATTGTTGAC Reverse: ACGTTGGATGATAGTTCACATCCTGCTGTG Probe: GGCTGAATGTCTGCCCC Forward: ACGTTGGATGGTGAAAGTTACTGCACCACC Reverse: ACGTTGGATGGAAAGGTACCCCAGAATGAG Probe: ACCACCACACGGAAAGC

419

Genetics Initiative reported significant associations between schizophrenia and RGS4 [Chowdari et al., 2002]. The involved haplotype encompassing four SNPs in the 50 flanking region of SNP1, SNP4, and SNP7 and the first intron of SNP18 of RGS4 in each of the US samples [Chowdari et al., 2002]. However different risk haplotypes have appeared across different ethnic groups and neither significant association was obtained for the Indian sample [Chowdari et al., 2002], nor for the Caucasian study [Sobell et al., 2005]. In this study, the four SNP markers of the RGS4 gene were tested for association in the population of Taiwan. This research project was approved by the Institutional Review Board of National Taiwan University Hospital. All genomic DNA samples were collected from the family subjects with at least two affected sibling after obtaining written informed consent. The subjects were recruited from two research programs; the multidimensional psychopathology study of schizophrenia (MPSS) [Hwu et al., 2002] from 1993 to 2001 and the Taiwan schizophrenia linkage study (TSLS) [Hwu et al., 2005] from 1998 to 2002. The 86 families of MPSS subjects were interviewed by the research psychiatrists using the Psychiatrist Diagnostic Assessment (PDA) [Hwu, 1999]. The 132 TSLS families were interviewed by well-trained assistants using the Mandarin Chinese version of the Diagnostic Interview for Genetic Studies (DIGS) [Chen, 1999]. For both studies, the final diagnostic assessment was formulated by integrating either the PDA or the DIGS data with clinical information from medical records using the specialist diagnostic assessment sheet (SDAS), based upon the criteria of the diagnostic and statistical manual of mental disorders, 4th edition (DSM-IV). This study sample included 218 schizophrenic nuclear families with at least two affected siblings, which include of 434 probands, 569 sib subjects, and 295 parent subjects. A total of 864 subjects participated in this genotyping study. All SNP markers were genotyped by the method of matrixassisted laser desorption/ionization-time of flight mass spectrometry (MALDI-TOF MS) (Table I). A DNA fragment (100­ 300 bp) encompassing the SNP site was amplified using the polymerase chain reaction (PCR) GeneAmp 9700 thermocycler

(Applied Biosystems, Foster City, CA) according to the manufacturer's instruction. After PCR amplification and neutralization of the deoxynucleotide triphosphate (dNTP), the primer extension was performed by adding the probe, Thermo Sequenase (Amersham Pharmacia, Piscataway, NJ) and appropriate dideoxynucleotide triphosphate (ddNTP)/ dNTP mixture. Different extension products were differentiated by mass through MALDI-TOF. We used the procedure ALLELE in SAS/GENETICS release 8.2 [SAS Institute, 2002] to assess Hardy­Weinberg equilibrium. Family relationships were verified by PEDCHECK version 1.1 [O'Connell and Weeks, 1998] and UNKNOWN version 5.23 [Terwilliger and Ott, 1994] to detect deviations from Mendelian inheritance. Linkage disequilibrium of intermarkers was measured using coefficient D' [Hedrick, 1987] which was also used to define haplotype blocks. The D' and Delta coefficients were calculated by the GOLD software [Abecasis et al., 2000]. Both single point and haplotype association analyses were carried out using TRANSMIT version 2.5.4 [Clayton, 1999]. Four RGS4 SNP markers (SNP1, SNP4, SNP7, and SNP18) were first validated in a small independent 92 individuals to insure the existence of these SNPs in the Taiwan ethnic group before typing the rest of the genomic samples. A SNP was considered valid if the frequency of minor allele was larger than 10% and genotyping missing rate was smaller than 30%. The SNP 1 could not be assessed accurately by MALDI-TOF MS method. The three remaining SNP markers were compatible with the Hardy­Weinberg equilibrium distribution (Table II). As SNP 1 is 498 bp close to SNP4, the significant association between SNP 1 and schizophrenia were controversial in Caucasian [Morris et al., 2004; Williams et al., 2004], and the SNP 1 did not show significant association with schizophrenia in the Han Chinese population [Zhang et al., 2005]. We suspect that this SNP is not critical in schizophrenia. The SNP4, SNP7, and SNP18 of RGS4 were analyzed by the TRANSMIT program version 2.5.4 [Clayton, 1999] which can utilize data from all families even when parental genotypes are unknown. No significant associations were found in either the single locus association analysis (Table II) or the haplotype

TABLE II. RGS4 Genotype Description and Single Locus Association Analysis LD SNP SNP 4 SNP 7 SNP18 Location Ch1:160220719 Ch1:160221068 Ch1:160227154 D' 0.929 0.824 0.791 Delta 0.692 0.534 0.398 (H-W) 0.50 (0.5845) 0.44 (0.5114) 0.47 (0.8659) MF N 215 216 215 Schizophrenia Chi 1.40 0.85 0.72 P-value 0.2369 0.3560 0.3966

LD, linkage disequilibrium of adjacent SNPs represented by D' and Delta; N, the number of informative family; MF, minor allele frequency; H­W, Hardy­ Weinberg P-value; Chi, the test statistics.

420

Liu et al.

Hollinger S, Hepler JR. 2002. Cellular regulation of RGS proteins: Modulators and integrators of G protein signaling. Pharmacol Rev 54:527­559. Hwu HG. 1999. Psychiatric diagnostic assessment. Taiwan: National Taiwan University. Hwu HG, Chen CH, Hwang TJ, Liu CM, Cheng JJ, Lin SK, Liu SK, Chi YY, Ou-Young CW, Lin HN, Chen WJ. 2002. Symptom patterns and subgrouping of schizophrenic patients: Significance of negative symptoms assessed on admission. Schizophr Res 56:105­119. Hwu HG, Liu CM, Fann CS, Ou-Yang WC, Lee SF. 2003. Linkage of schizophrenia with chromosome 1q loci in Taiwanese families. Mol Psychiatry 8:445­452. Hwu HG, Faraone SV, Liu CM, Chen WJ, Liu SK, Shieh MH, Hwang TJ, Tsuang MM, OuYang WC, Chen CY, Chen CC, Lin JJ, Chou FH, Chueh CM, Liu WM, Hall MH, Tsuang MT. 2005. Taiwan schizophrenia linkage study: The field study. Am J Med Genet B 134B:30­36. Ishii M, Kurachi Y. 2003. Physiological actions of regulators of G-protein signaling (RGS) proteins. Life Sci 74:163­171. Larminie C, Murdock P, Walhin JP, Duckworth M, Blumer KJ, Scheideler MA, Garnier M. 2004. Selective expression of regulators of G-protein signaling (RGS) in the human central nervous system. Mol Brain Res 122:24­34. Mirnics K, Middleton FA, Lewis DA, Levitt P. 2001a. Analysis of complex brain disorders with gene expression microarrays: Schizophrenia as a disease of the synapse. Trends Neurosci 24:479­486. Mirnics K, Middleton FA, Stanwood GD, Lewis DA, Levitt P. 2001b. Diseasespecific changes in regulator of G-protein signaling 4 (RGS4) expression in schizophrenia. Mol Psychiatry 6:293­301. Morris DW, Rodgers A, McGhee KA, Schwaiger S, Scully P, Quinn J, Meagher D, Waddington JL, Gill M, Corvin AP. 2004. Confirming RGS4 as a susceptibility gene for schizophrenia. Am J Med Genet B 125B: 50­53. O'Connell JR, Weeks DE. 1998. PedCheck: A program for identification of genotype incompatibilities in linkage analysis. Am J Hum Genet 63:259­266. Owen MJ, Williams NM, O'Donovan MC. 2004. The molecular genetics of schizophrenia: New findings promise new insights. Mol Psychiatry 9:14­27. SAS Institute. 2002. SAS/Genetics User's Guide. Saugstad JA, Marino MJ, Folk JA, Hepler JR, Conn PJ. 1998. RGS4 inhibits signaling by group I metabotropic glutamate receptors. J Neurosci 18:905­913. Sobell JL, Richard C, Wirshing DA, Heston LL. 2005. Failure to confirm association between RGS4 haplotypes and schizophrenia in Caucasians. Am J Med Genet B 139B:23­27. Taymans JM, Leysen JE, Langlois X. 2003. Striatal gene expression of RGS2 and RGS4 is specifically mediated by dopamine D1 and D2 receptors: Clues for RGS2 and RGS4 functions. J Neurochem 84:1118­1127. Taymans JM, Kia HK, Claes R, Cruz C, Leysen J, Langlois X. 2004. Dopamine receptor-mediated regulation of RGS2 and RGS4 mRNA differentially depends on ascending dopamine projections and time. Eur J Neurosci 19:2249­2260. Terwilliger JD, Ott J. 1994. Handbook of Human Genetic Linkage. Williams NM, Preece A, Spurlock G, Norton N, Williams HJ, McCreadie RG, Buckland P, Sharkey V, Chowdari KV, Zammit S, Nimgaonkar V, Kirov G, Owen MJ, O'Donovan MC. 2004. Support for RGS4 as a susceptibility gene for schizophrenia. Biol Psychiatry 55:192­195. Zhang F, St Clair D, Liu X, Sun X, Sham PC, Crombie C, Ma X, Wang Q, Meng H, Deng W, Yates P, Hu X, Walker N, Murray RM, Collier DA, Li T. 2005. Association analysis of the RGS4 gene in Han Chinese and Scottish populations with schizophrenia. Genes Brain Behav 4:444­ 448.

TABLE III. Haplotype Analyses of all Families Using Transmit v2.5.4 Program Schizophrenia N ¼ 216 Haplotype (SNP4-SNP7-SNP18) A-G-A C-G-A A-A-A C-G-G A-A-G Haplotype frequency 0.0573 0.0560 0.4273 0.4409 0.0185 Chi 0.10 0.05 1.18 0.74 0.02 P-value 0.7467 0.8283 0.2773 0.3911 0.8790

N, number of families with transmissions to affected offspring.

association analysis (Table III) in the DSM-IV diagnosed schizophrenia. Our result did not support the RGS4 promoter regions (SNP4, SNP7) and intron 1 (SNP18) to be the susceptible region for schizophrenia. As this region is located at the declining region of the genome wide mapping 1q21­22, we suspect that the RGS4 gene may be not the major positional candidate gene for schizophrenia in this region. Most of the replication studies with significant association of schizophrenia and RGS4 were presented in Caucasian samples [Morris et al., 2004; Williams et al., 2004], but not in Indian [Chowdari et al., 2002] and Taiwan. It is possible that the RGS4 is not involved in the pathogenesis of schizophrenia in the Asian population. These results suggest that if RGS4 is a candidate gene for schizophrenia, it seems to have much less influence on the ethnic group of Taiwan Chinese. ACKNOWLEDGMENTS We acknowledge the support from Department of Medical Research and the SNP genotyping works done by the National Genotyping Center (NGC). REFERENCES

Abecasis GR, Cardon LR, Cookson WO. 2000. A general test of association for quantitative traits in nuclear families. Am J Hum Genet 66:279­292. Brzustowicz LM, Hayter JE, Hodgkinson KA, Chow EW, Bassett AS. 2002. Fine mapping of the schizophrenia susceptibility locus on chromosome 1q22. Hum Hered 54:199­209. Chen WJ. 1999. Diagnostic Interview for Genetic Studies (DIGS) Mandarin version 2.0. Chowdari KV, Mirnics K, Semwal P, Wood J, Lawrence E, Bhatia T, Deshpande SN, B KT, Ferrell RE, Middleton FA, Devlin B, Levitt P, Lewis DA, Nimgaonkar VL. 2002. Association and linkage analyses of RGS4 polymorphisms in schizophrenia. Hum Mol Genet 11:1373­1380. Clayton D. 1999. A generalization of the transmission/disequilibrium test for uncertain-haplotype transmission. Am J Hum Genet 65:1170­1177. Dohlman HG, Thorner J. 1997. RGS proteins and signaling by heterotrimeric G proteins. J Biol Chem 272:3871­3874. Erdely HA, Lahti RA, Lopez MB, Myers CS, Roberts RC, Tamminga CA, Vogel MW. 2004. Regional expression of RGS4 mRNA in human brain. Eur J Neurosci 19:3125­3128. Hedrick PW. 1987. Gametic disequilibrium measures: Proceed with caution. Genetics 117:331­341.

Information

Evaluation of RGS4 as a candidate gene for schizophrenia

3 pages

Find more like this

Report File (DMCA)

Our content is added by our users. We aim to remove reported files within 1 working day. Please use this link to notify us:

Report this file as copyright or inappropriate

363921


You might also be interested in

BETA
FIS84-4_.final
Evaluation of RGS4 as a candidate gene for schizophrenia
Microsoft Word - ETHTOM Final Report FORMATTED.doc