Read Antimicrobial Activity of Basil (Ocimum basilicum) Oil against Salmonella Enteritidis in Vitro and in Food text version

Biosci. Biotechnol. Biochem., 74 (6), 1200­1204, 2010

Antimicrobial Activity of Basil (Ocimum basilicum) Oil against Salmonella Enteritidis in Vitro and in Food

Pongsak R ATTANACHAIKUNSOPONy and Parichat P HUMKHACHORN

Department of Biological Science, Ubon Ratchathani University, Warin Chamrap, Ubon Ratchathani 34190, Thailand

Received December 17, 2009; Accepted March 26, 2010; Online Publication, June 7, 2010 [doi:10.1271/bbb.90939]

Nine essential oils were examined for antimicrobial activity against reference and clinical strains of Salmonella Enteritidis. Based on the size of the inhibition zone and the minimal inhibitory concentration, basil oil had the strongest antimicrobial activity against all the tested bacteria, and S. Enteritidis SE3 was the most sensitive strain to all the tested oils. Gas chromatography/mass spectrometry analysis revealed that the major constituents of the oil were linalool (64.35%), 1,8-cineole (12.28%), eugenol (3.21%), germacrene D (2.07%), terpineol (1.64%), and -cymene (1.03%). When applied in nham, a fermented pork sausage, experimentally inoculated with S. Enteritidis SE3 and stored at 4 C, basil oil inhibited the bacterium in a dose-dependent fashion. Basil oil at a concentration of 50 ppm reduced the number of bacteria in the food from 5 to 2 log cfu/g after storage for 3 d. An unmeasurable level of the bacterium in the food was observed at days 2 and 3 of storage when 100 and 150 ppm of basil oil was used, respectively. Sensory evaluation suggested that the addition of 100 but not of 150 ppm to nham would be acceptable to consumers. The results from this study confirm the potential use of basil oil as an antimicrobial agent to control S. Enteritidis in food. Key words: antimicrobial activity; basil oil; Ocimum basilicum; Salmonella Enteritidis

natural antimicrobial substances to be used in foods because many of them have been part of the human diet for hundreds of years, and have been reported to possess antimicrobial activity.4) Essential oils are aromatic oily liquids obtained from many parts of plants, including the flowers, buds, seeds, leaves, twigs, bark, wood, fruit, and roots. Although many methods have been used to obtain essential oils from plant materials, the most commonly used method is steam distillation. Some essential oils have long been recognized to possess antimicrobial properties.5­7) Research on the use of essential oils to control populations of foodborne pathogenic bacteria is increasing. Many of these oils have promising ability to reduce bacteria both in vitro and in foods.7­10) These data encouraged us to search for a potential essential oil to control S. Enteritidis in food. In this study, nine essential oils extracted from herbs and spices normally used in Thai foods were evaluated for antimicrobial activity against one reference and five clinical strains of S. Enteritidis. The most active one was further studied for its composition and its potential to serve as an antimicrobial agent when applied to food experimentally contaminated with S. Enteritidis.

Materials and Methods

Bacterial strains and culture conditions. A total of six strains of S. Enteritidis were included in the study. One of them was a reference strain obtained from the American Type Culture Collection (ATCC), S. enterica subsp. enterica serovar Enteritidis ATCC 10708. The other bacteria were clinical strains, SE1 to SE5. The identities of the bacterial strains were confirmed by polymerase chain reaction using two primers, 50 CTTTGGTCATAAAATAAGGCG30 and 50 TGCCCAAAGCAGAGAGCTTC30 , following the method described by Minami et al.11) These primers are specific for the Salmonella enterotoxin (stn) gene. The expected size of the PCR product was 260 bp. All the bacteria used in this study were grown at 37 C in BHI (brain heart infusion) broth. Bacterial stock cultures were stored as frozen cultures at À80 C in BHI broth containing 20% glycerol v/v. Throughout the experiments, the strains were subcultured every 2 weeks on BHI agar and kept at 4 C. Before use, liquid cultures prepared from a single colony were transferred twice into fresh BHI broth and incubated at 37 C for 24 h. Preparation of essential oils. The plants used are listed in Table 1. All of them were purchased from an herb shop, Ban Samunprai, in Pranakorn, Bangkok, Thailand. They were sold as dried materials with identification certificates approved by the Royal Forest Department, Bangkok. Plant essential oils were prepared by steam distillation. Two hundred g of each sample was cut into small pieces and homogenized in 200 ml of distilled water using a blender. The homogenate was

Salmonellas are members of the Enterobacteriaceae. Based on somatic, flagellar, and capsular antigen types, over 2,000 serotypes of Salmonella have been classified. Among these, S. enterica subsp. enterica serotype Enteritidis (also known as Salmonella Enteritidis) is the most common causative agent of foodborne salmonellosis. In addition, S. Enteritidis has been recognized as a major cause of all foodborne diseases due to pathogenic bacteria.1­3) Salmonella infection in humans mainly results from consumption of contaminated foods, especially ones of animal origin, including pork, beef, chicken, egg, and milk. Foodborne salmonellosis is characterized by gastrointestinal disorders manifested predominantly by diarrhea and abdominal cramps. Since the disease not only affects people's health and well-being, but also has an economic impact on individuals and countries, many efforts have been spent to find approaches to reduce or eliminate Salmonella that contaminates foods. The addition of antimicrobial substances to foods can be used to improve the safety of foods. Plants and plant products represent a source of

y

To whom correspondence should be addressed. Tel: +66-45-288380; Fax: +66-45-288389; E-mail: [email protected]

Antimicrobial Activity of Basil Oil Table 1. List of Plants and Their Parts Used for Essential Oil Extraction, and Yields of the Extracted Oils Common names Basil Cinnamon Clove Fingerroot Garlic Lemongrass Oregano Thyme Tumeric

a

1201

Scientific names Ocimum basilicum Cinnamomum verum Eugenia caryophyllus Boesenbergia pandurata Allium sativum Cymbopogon citrates Salvia officinalis Thymus vulgaris Curcuma longa

Parts used Leaf Bark Flower bud Root Bulb Stem leaf leaf Root

Oil yielda (%, v/w) 1.86 2.05 1.93 1.67 2.03 2.24 1.89 1.92 1.47

[amount of essential oil (ml)/amount of dried plant material (g)] Â 100

subjected to essential oil extraction using a vertical steam distillation unit. The extracted essential oil was kept in a dark bottle and stored at 4 C until use. The yield of each essential oil is presented in Table 1. Antimicrobial activity testing. The antimicrobial activity of each essential oil against S. Enteritidis was evaluated by the swab paper disc method,12) with some modifications. Bacterial culture (0.2 ml, 105 CFU/ml) was spread with a sterile swab on BHI agar, and then sterile filter paper discs 6 mm in diameter (Schleicher & Schuell, Dassel, Germany) were placed on the agar. Each essential oil was dissolved in 10% aqueous dimethylsulfoxide (DMSO) supplemented with 0.5% Tween 80 at a ratio of 1:1 and sterilized by filtration through a 0.45-mm membrane filter. Thirty ml of the essential oil was spotted on the paper disc. Aqueous dimethylsulfoxide (DMSO) supplemented with 0.5% Tween 80 was used as a control. After incubation at 37 C for 24 h, the diameter of each growth-free zone around the disc was measured and the diameter of the paper disc subtracted, giving the size of each inhibition zone beyond the paper disc. Studies were performed in triplicate. Minimal inhibitory concentration (MIC) assay. The MICs of the essential oils for the inhibition of S. Enteritidis were determined by the agar dilution method as described by Prudent et al.,13) with some modifications. A series of 2-fold dilutions of each oil, ranging from 10 to 1,280 mg/ml, was prepared in BHI agar supplemented with 0.5% v/v Tween 80. The plates were dried at room temperature for 1 h prior to spot inoculation with 3-ml aliquots of culture containing approximately 105 CFU/ml of S. Enteritidis. The inoculated plates were incubated at 37 C for 24 h, and the MIC was determined. The experiments were carried out in triplicate. Inhibition of bacterial growth on the plates containing the tested oil was judged by comparison with growth on blank control plates. The MICs were determined as the lowest concentration of oil inhibiting visible growth of the organism on the agar plate. Identification of essential oil components. The essential oil components were analyzed on a Finnigan Trace GC-Polaris Q mass instrument (Finnigan-Spectronex, Thermo, San Jose, CA), equipped with a fused silica column (30 m  0:25 mm i.d.), and coated with DB5MS (df ¼ 0:25 mm). Mass spectra were recorded over a 50­650 amu range at 1 scan/s, with an ionization energy of 70 eV and an ion source temperature of 200 C. Helium was the carrier gas, at a flow rate of 1 ml/min. The injector temperature was maintained at 250 C. One ml of cinnamon oil solution in ethyl acetate (1:100 v/v) was injected at a 1:10 split ratio. The essential oil was held at 60 C for 1 min, raised to 200 C at a rate of 3 C/min, and held for 10 min. Identification of individual compartments was done using the Wiley/NBS Registry of the Mass Spectral Database and NIST MS search, the literature,14) and authentic reference compounds. The quantity of the compounds was obtained by integrating the peak area of the spectrograms. Examination of antimicrobial activity of basil oil in food. Nham was used as the food model in this study because it has a tendency to be contaminated with foodborne pathogens and is often consumed raw.15) Four hundred g of food sample was prepared by mixing the ingredients, ground pork (62.5%), boiled, sliced pork rinds (27.5%), salt (2.5%), sugar (2.5%), and ground roasted rice (10%). The resulting

mixture was divided into two groups of four samples (50 g each). Four different concentrations of basil oil (0, 50, 100, and 150 ppm) were added separately to the 50-g samples of both groups of food. To ensure a homogeneous distribution of basil oil in the food, the food was mixed with a BagMixer 100 (Interscience, Paris, France). S. Enteritidis SE3 was then inoculated into every sample of only one group to obtain a final concentration of about 105 CFU/g. All the 50-g food samples were further divided into 10-g portions, which were tightly packaged in sampling bags (Interscience, Paris, France) separately and incubated for 5 d at 4 C. Food samples containing only basil oil and ones containing only S. Enteritidis SE3 were used as controls. During the 5-d incubation period, a 10-g food portion was taken daily from each group under the various treatments and subjected to bacterial isolation. Each sample taken was transferred to a sterile Stomacher bag, and 10 ml of phosphate buffer (pH 7) was added to the bag. After homogenization in a Stomacher apparatus for 30 s, only the liquid part of the homogenate was collected, and this was serially diluted with phosphate buffer. Appropriate dilutions of each sample were spread on CHROMagar Salmonella agar (CHROMagar, Paris, France), a selective medium for Salmonella. Bacterial colonies grown on the agar were confirmed to be S. Enteritidis by the method described above. The numbers of bacterial cells grown on CHROMagar Salmonella agar were used to calculate the concentration of the bacteria in food. This experiment was performed in triplicate. The steps involved in the examination of the antimicrobial activity of basil oil against S. Enteritidis SE3 in the nham are summarized in Fig. 1. Sensory evaluation. Nham samples (10 g each) were treated with basil oil at concentrations of 0 (control), 100, and 150 ppm. The samples were stored for 5 d at 4 C prior to evaluation. To determine whether the addition of basil oil to nham influenced consumer liking for the food, 20 panelists evaluated the food on a 9-point hedonic scale for overall liking of the food and liking of the appearance, aroma, flavor, and texture individually. FIZZ sensory analysis software (Biosystems, Couternon, France) was used for data analysis. Data were analyzed by ANOVA with sample and panelists as factors in the model. Tukey's test (p < 0:05) was used for mean separation.

Results

Using the swab paper disc method for examination of the antimicrobial activity of nine different essential oils against reference and clinical strains of S. Enteritidis, it was found that all of the oils inhibited the bacterial strains, with various degrees of inhibition. Based on sizes of the inhibition zone, basil oil had the highest antimicrobial activity of any tested bacterial strain (Table 2). Among all of the tested bacteria, S. Enteritidis SE3 was the most sensitive strain to all of the essential oils (Table 2). Determination of the MICs of the essential oils for inhibition of the reference and clinical strains of S. Enteritidis was also performed. The results are shown in Table 3. The results of the swab paper disc method (Table 2) and those of the MIC determination assay (Table 3) were in agreement. Of all the tested oils, basil oil had the lowest MIC values for all strains of S. Enteritidis, indicating the strongest antimicrobial activities. The lowest MIC value (20 mg/ml) was obtained when S. Enteritidis SE3 was inhibited by basil oil. Since S. Enteritidis SE3 was the most sensitive strain to basil oil, it was selected for further experiments. Being the most effective essential oil in inhibiting S. Enteritidis, the chemical composition of basil oil was investigated. Based on GC and GC-MS analysis of basil oil, 40 components were identified, representing 98.46% of the total detected constituents. The major constituents of the oil were linalool (64.35%), 1,8-cineole (12.28%), eugenol (3.21%), germacrene D (2.07%), -terpineol

1202

P. R ATTANACHAIKUNSOPON and P. P HUMKHACHORN

400-g sample

Group of 50-g samples

Group of 50-g samples

Basil oil (ppm) S. Enteritidis (105 CFU/g)

0 -

50 -

100 -

150 -

0 +

50 +

100 +

150 +

Groups of 10-g portions

A portion from each group was taken daily for 5 d for bacterial isolation on CHROMagar Salmonella agar.

Fig. 1. Summary of the Steps Involved in the Examination of Antimicrobial Activity of Basil Oil against S. Enteritidis SE3 in Nham. Table 2. Antimicrobial Activity of Essential Oils against Various Strains of S. Enteritidis as Studied by the Swab Paper Disc Method Essential oil ATCC 10708 Basil oil Cinnamon oil Clove oil Fingerroot oil Garlic oil Lemongrass oil Oregano oil Thyme oil Tumeric oil

a

Inhibition zone (mm)a SE1 20:2 Æ 0:8 17:7 Æ 1:0 18:4 Æ 1:2 11:7 Æ 0:9 20:8 Æ 1:4 16:8 Æ 1:3 19:4 Æ 0:4 17:7 Æ 1:3 15:2 Æ 1:6 SE2 25:3 Æ 1:1 19:1 Æ 0:9 14:5 Æ 0:4 8:2 Æ 0:5 18:6 Æ 1:1 19:2 Æ 1:0 12:6 Æ 0:5 18:4 Æ 0:6 12:7 Æ 0:9 SE3 29:4 Æ 1:2 20:7 Æ 0:6 24:3 Æ 0:7 15:2 Æ 0:6 22:6 Æ 1:6 21:3 Æ 1:4 24:1 Æ 1:1 20:8 Æ 0:9 18:5 Æ 1:3 SE4 24:4 Æ 0:8 13:2 Æ 0:7 19:7 Æ 1:2 9:4 Æ 0:4 12:2 Æ 0:7 17:3 Æ 0:3 18:3 Æ 1:3 12:5 Æ 0:5 13:6 Æ 1:4 SE5 26:3 Æ 0:7 16:5 Æ 0:5 12:4 Æ 1:1 7:5 Æ 0:8 15:9 Æ 1:2 16:4 Æ 0:8 14:4 Æ 0:5 16:3 Æ 1:0 16:4 Æ 0:6

27:6 Æ 1:5 20:3 Æ 0:6 16:2 Æ 1:5 10:3 Æ 0:8 17:1 Æ 1:2 15:5 Æ 1:1 12:1 Æ 0:6 17:3 Æ 1:1 15:8 Æ 0:8

Results are mean Æ SD values for three replicates.

Table 3. MICs of Essential Oils against Various Strains of S. Enteritidis Essential oil ATCC 10708 Basil oil Cinnamon oil Clove oil Fingerroot oil Garlic oil Lemongrass oil Oregano oil Thyme oil Tumeric oil

a

MIC (mg/ml)a SE1 80:0 Æ 0:0 133:3 Æ 37:7 160:0 Æ 0:0 320:0 Æ 0:0 106:7 Æ 37:7 160:0 Æ 0:0 160:0 Æ 0:0 160:0 Æ 0:0 160:0 Æ 0:0 SE2 40:0 Æ 0:0 160:0 Æ 0:0 320:0 Æ 0:0 640:0 Æ 0:0 160:0 Æ 0:0 160:0 Æ 0:0 106:7 Æ 37:7 160:0 Æ 0:0 320:0 Æ 0:0 SE3 20:0 Æ 0:0 66:7 Æ 18:9 80:0 Æ 0:0 213:3 Æ 75:4 80:0 Æ 0:0 80:0 Æ 0:0 80:0 Æ 0:0 66:7 Æ 18:9 133:3 Æ 37:7 SE4 80:0 Æ 0:0 266:7 Æ 75:4 133:3 Æ 37:7 640:0 Æ 0:0 320:0 Æ 0:0 133:3 Æ 37:7 160:0 Æ 0:0 320:0 Æ 0:0 320:0 Æ 0:0 SE5 53:3 Æ 18:9 160:0 Æ 0:0 320:0 Æ 0:0 640:0 Æ 0:0 160:0 Æ 0:0 160:0 Æ 0:0 160:0 Æ 0:0 160:0 Æ 0:0 160:0 Æ 0:0

40:0 Æ 0:0 80:0 Æ 0:0 160:0 Æ 0:0 320:0 Æ 0:0 160:0 Æ 0:0 160:0 Æ 0:0 66:7 Æ 18:9 106:7 Æ 37:7 160:0 Æ 0:0

Results are mean Æ SD values for three replicates.

(1.64%), and -cymene (1.03%). Other chemical compounds were present in amounts, less than 1.0%. The major components and their retention times are summarized in Table 4. When basil oil was added to nham experimentally inoculated with S. Enteritidis SE3 and stored at 4 C for 5 d, the response of the bacterial strain varied depending on the concentration of basil oil added. Without basil oil, the number of S. Enteritidis SE3 remained stable, at

about 5 log cfu/g throughout the experiment (Fig. 2). In nham with 50 ppm of basil oil, the number of bacteria fell rapidly in the first 3 d of storage, from about 5 log cfu/g to 2 log cfu/g. After that, no change in bacterial cell number was observed (Fig. 2). An unmeasurable cell number ( 10 cfu/g or 1 log cfu/g) of S. Enteritidis SE3 was obtained in the nham samples treated with basil oil at concentrations of 100 and 150 ppm after 3 and 2 d of the storage respectively. No S. Enteritidis SE3 cells were

Antimicrobial Activity of Basil Oil Table 4. Retention Times and Relative Contents of Major Components of Basil Essential Oil as Determined by GC-MS Analysis No. 1 2 3 4 5 6

a b

1203

Table 5. Mean Sensory Scores for Nham Treated with Various Concentrations of Basil Oil Attribute 0 Overall liking Appearance Aroma Flavor Texture Concentration of basil oil (ppm) 100 6.4a 6.6a 6.2a 6.4a 6.6a 150 4.6b 6.3a 4.9b 5.1b 6.4a

Compound -cymene 1,8-cineole linalool -terpineol eugenol germacrene D

Relative content (%) 1.03 12.28 64.35 1.64 3.21 2.07

RTa 14.13 14.36 16.75 19.04 24.10 27.32

KIb 1038 1045 1118 1194 1369 1498

6.5a 6.4a 6.3a 6.5a 6.6a

Retention time (min) Kovats retention index relative to n-alkenen (C9 ­C12 ).

4 ¼ dislike slightly, 5 ¼ neither like nor dislike, 6 ¼ like slightly, 7 ¼ like moderately. Means within the same row with the same letter are not significantly different (p < 0:05).

5.5 5 Viable count (log cuf/g) 4.5 4 3.5 3 2.5 2 1.5 1 0.5 0 0 1

Unmeasurable zone

Discussion

Basil (Ocimum basilicum) is an annual, aromatic, branched herb, 30 to 150 cm high. Traditionally, it is used for medicinal purposes as a digestive stimulant and for treatment of headaches, coughs, diarrhea, insomna, constipation, warts, wounds, and kidney malfunction.16,17) Basil leaf oil is used principally in the food and cosmetic industries.17) It has wide applications as a spice in a variety of foods, beverages, and confectionary products. It also possesses antimicrobial activity, and some of its components such as, linalool, 1,8-cineole, euglenol, estragole, and camphor, are known to be biologically active.18,19) The major components of basil oil vary extensively, depending on genetic factors, geographical origins, nutritional status, the extracted plant materials (stem, leaf, and flower), extraction methods, and so on.20) Basil oil is traditionally classified into four distinct chemotypes with many subtypes, based on the biosynthetic pathways that produce the principal components in the oil. The different chemotypes contain various proportions of allyl-phenol derivatives, inclung estragole (methylchavicol), eugenol, and methyl eugenol, as well as linalool, a monoterpene alcohol.21­23) Because of the variation in the chemical composition of basil oil, it is of interest to investigate the components of the basil oil used in this study. Our results showed that the oil contained major compounds, linalool (64.35%), 1,8-cineole (12.28%), eugenol (3.21%), germacrene D (2.07%), -terpineol (1.64%), and -cymene (1.03%). These findings are different from those of Simon et al.21) and Lawrence et al.,24) who found that Thai basil oil was rich in methyl eugenol. Differences in the chemical composition of basil oil of the same geographical origin are not unusual. A similar situation was found for Turkish basil oil. Simon et al. classified chemotaxonomically Turkish basil oils into different groups, linalool-rich and linalool-and-methylchavicol rich groups.21) Furthermore, Chalchat and Ozcan reported that the oil of Turkish basil was rich in estragole but had very low amounts of linalool.25) Considering the large number of different groups of chemical compounds present in essential oils, it is most likely that their antimicrobial activity is not attributable to one specific mechanism and that there are several targets in the cells.7) Several possible antimicrobial mechanisms of essential oils and their components have been proposed, including degradation of the cell wall,26) damage to the cytoplasmic membrane,27) damage to membrane proteins,28) leakage of cell contents,26) coag-

2

3

4

5

Time (d)

0 ppm 50 ppm 100 ppm 150 ppm

Fig. 2. Effects of Basil Oil at Different Concentrations on the Survival of S. Enteritidis SE3 Experimentally Inoculated in Nham Samples. , , , and represent nham samples containing basil oil at concentrations of 0, 50, 100, and 150 ppm respectively.

initially detected in the food samples, and viable counts remained undetectable throughout the experiments (Fig. 2). Basil oil at a concentration of 100 ppm also resulted in an undetectable count ( 10 cfu/g or 1 log cfu/g) of the rest of the tested strains of S. Enteritidis (ATCC 10708, SE1, SE2, SE4, and SE5) in the nham after 3 d of storage (data not shown). The effects of basil oil added to nham samples on overall liking, appearance, aroma, flavor, and texture were investigated. The results of analysis of variance showed that there were no significant differences (p < 0:05) among the three samples (with 0, 100, and 150 ppm of basil oil) for hedonic scores for appearance and texture. The means of all of these attributes fell between like slightly and like moderately on the hedonic scale (Table 5). However, there were significant differences (p < 0:05) among the three samples for overall liking, liking of aroma, and liking of flavor. The control (0 ppm of basil oil) had the same liking level for overall, aroma and flavor as that of the nham sample with 100 ppm of basil oil. Based on the same attributes, both the control and the sample with 100 ppm of basil oil were liked more than the sample with 150 ppm of basil oil (Table 5). The mean scores for aroma and flavor of the samples with 150 ppm of basil oil were close to the neither like nor dislike point on the scale, while that of overall liking was on a level between dislike slightly and neither like nor dislike. These results suggest that the addition of 100 ppm of basil oil to nham would be acceptable to consumers.

1204

29)

P. R ATTANACHAIKUNSOPON and P. P HUMKHACHORN

ulation of cytoplasm, and depletion of proton motive force.30) Therefore, to understand the precise mode of action and antimicrobial activity of a particular essential oil, a knowledge of its chemical compositions is required. Among the major components found in the basil oil used in this study, all, except for -cymene, have been reported to have antimicrobial activity.4,7) Furthermore, we also found that they inhibited all strains of S. Enteritidis tested in this study (data not shown). Hence, to use basil oil as a natural agent to improve food safety is to take advantage of all the active compounds present in the oil. Even though -cymene did not have antimicrobial activity, it may support or enhance the activity of other antimicrobial compounds in basil oil. Delgado et al. reported that -cymene increased the antimicrobial activity of thymol in controlling the growth of Bacillus cereus both in vitro and in food.31) Examination of the synergistic effect between -cymene and the other major compounds found in the basil oil of this study both in vitro and in food is an interesting issue that is under investigation in our laboratory. The results obtained from studies in vitro and in food of the antimicrobial activity of a substance against particular bacteria can be different. Rajkovic et al. reported that carvacrol, which inhibited the growth of Bacillus cereus and Bacillus circulans in nutrient broth, failed to exhibit any antimicrobial properties when used in potato puree.32) Interference in the antimicrobial potency of chitosan hydrolysates by food matrices, juice and dip, was also observed.33) For these reasons, it is necessary to evaluate the antimicrobial activity of basil oil in food. In this study, nham was used as the food model to evaluate the inhibitory effect of basil oil on S. Enteritidis SE3. Basil oil was found to inhibit S. Enteritidis SE3 experimentally inoculated into nham in a dose-dependent pattern. The concentrations of the oil used to inhibit the growth of S. Enteritidis SE3 in the in vitro (20 mg/ml or 20 ppm) and the food (100 and 150 ppm) experiments were substantially different. The ratio of the inhibitory concentrations was about 5- to 7.5fold. These results are similar to those obtained in studies of the antimicrobial activity of many essential oils against bacteria in vitro and in foods. For essential oils exhibiting antimicrobial activity in vitro, it has generally been found that higher concentrations of the oils are needed to achieve the same effects in foods.7) The ratio has been recorded to range from 100-fold (in soft cheese) to 10-fold (in pork liver sausage). Although the causes of this phenomenon are still unknown, several explanations have been offered. The food matrices might serve as barriers protecting bacterial cells from inhibitory substances. In addition, the greater availability of nutrients in foods as compared to laboratory media enable bacteria to repair damaged cells faster. Both the intrinsic properties of food (water content, protein content, pH, salt, and other additives) and extrinsic factors (temperature, the characteristics of the microorganisms) have been found to be relevant in this respect.7) Based on its antimicrobial activity against S. Enteritidis both in vitro and in a food model and acceptance by consumers when applied in food, basil oil is a candidate for a food preservative.

References

1) 2) 3) Ray B and Bhunia A, ``Foodborne Infections,'' eds. Ray B and Bhunia A, CRC Press, New York, pp. 283­313 (2008). Murray PR, ``Enterobacteriaceae,'' ed. Farrell R, MosbyYear Book Inc., London, pp. 227­240 (1994). Adams MR and Moss MO, ``Bacterial Agents of Foodborne Illness,'' eds. Adams MR and Moss MO, The Royal Society of Chemistry, Cambridge, pp. 184­271 (2000). Cowen MM, Clin. Microbiol. Rev., 12, 564­582 (1999). Deans SG and Ritchie GA, Int. J. Food Microbiol., 5, 165­180 (1987). Dorman HJD and Deans SG, J. Appl. Microbiol., 88, 308­316 (2000). Burt S, Int. J. Food Microbiol., 94, 223­253 (2004). Belletti N, Lanciotti R, Patrignani F, and Gardini F, J. Food Sci., 73, 331­338 (2008). Rattanachaikunsopon P and Phumkhachorn P, Biosci. Biotechnol. Biochem., 72, 2987­2991 (2008). Nannapaneni R, Chalova VI, Crandall PG, Ricke SC, Johnson MG, and O'bryan CA, Int. J. Food Microbiol., 129, 43­49 (2009). Minami A, Chaicumpa W, Chongsa-Nguan M, Samosornsuk S, Monden S, Takeshi K, Makino S, and Kawamoto K, Food Control, 21, 221­226 (2010). Rattanachaikunsopon P and Phumkhachorn P, J. Sci. KKU, 26, 281­288 (1998). Prudent D, Perineau F, Bessiere JM, Michel GM, and Baccou JC, J. Essen. Oil Res., 7, 165­173 (1995). Adams RP, ``Identification of Essential Oil Components by Gas Chromatography/Quadrupole Mass Spectroscopy,'' Allured Publishing, Carol Stream (2001). Chokesajjawatee N, Pornaem S, Zo Y-G, Kamdee S, Luxananil P, Wanasen S, and Valyasevi R, Food Microbiol., 26, 547­551 (2009). Simon JE, Morales MR, Phippen WB, Vieira RF, and Hao Z, ``A Source of Aroma Compounds and a Popular Culinary and Ornamental Herb,'' ed. Janick J, ASHA Press, Alexandria, pp. 499­505 (1999). Javanmardi J, Khalighi A, Kashi A, Bais HP, and Vivanco JM, J. Agric. Food Chem., 50, 5878­5883 (2002). Prasad G, Kuman A, Singh AK, Bhattacharya AK, Singh K, and Sharma VD, Fitoterapia, 57, 429­432 (1986). Morris JA, Khettry A, and Seitz EWM, J. Am. Oil Chem. Soc., 56, 595­603 (1979). Suppakul P, Miltz J, Sonneveld K, and Bigger SW, J. Agric. Food Chem., 51, 3197­3207 (2003). Simon JE, Quinn J, and Murray RG, ``Basil: A Source of Essential Oils,'' eds. Janick J and Simon JE, Timber Press, Portland, pp. 484­489 (1990). Grayer RJ, Kite GC, Goldstone FJ, Bryan SE, Paton A, and Putievsky E, Phytochemistry, 43, 1033­1039 (1996). Marotti M, Piccaglia R, and Giovanelli E, J. Agric. Food Chem., 44, 3926­3929 (1996). Lawrence BM, Hogg JW, Terhune SJ, and Pichitakul N, Flavour Ind., 3, 47­49 (1972). Chalchat J-C and Ozcan MM, Food Chem., 110, 501­503 (2008). Helander IM, Alakomi HL, Latva-Kala K, Mattila-Sandolm T, Pol I, Smid EJ, Gorris LGM, and von Wright A, J. Agric. Food Chem., 46, 3590­3595 (1998). Ultee A, Bennik MHJ, and Moezelar R, Appl. Environ. Microbiol., 68, 1561­1568 (2002). Juven BJ, Kanner J, Schved F, and Weisslowicz H, J. Appl. Bacteriol., 76, 626­631 (1994). Gustafson JE, Liew YC, Chew S, Markham JL, Bell HC, Wyllie SG, and Warmingto JR, Lett. Appl. Microbiol., 26, 194­198 (1998). Ultee A and Smid EJ, Int. J. Food Microbiol., 64, 373­378 (2001). Delgado B, Palop A, Fernanez PS, and Periago PM, Eur. Food Res. Technol., 218, 188­193 (2004). Rajkovic A, Uyttendaele M, Courtens T, and Debevere J, Food Microbiol., 22, 189­197 (2005). Rhodes J and Roller S, Appl. Environ. Microbiol., 66, 80­86 (2000).

4) 5) 6) 7) 8) 9) 10) 11)

12) 13) 14)

15)

16)

17) 18) 19) 20) 21)

22) 23) 24) 25) 26)

27) 28) 29)

30) 31) 32) 33)

Information

Antimicrobial Activity of Basil (Ocimum basilicum) Oil against Salmonella Enteritidis in Vitro and in Food

5 pages

Report File (DMCA)

Our content is added by our users. We aim to remove reported files within 1 working day. Please use this link to notify us:

Report this file as copyright or inappropriate

461833


You might also be interested in

BETA
Handbook.of.Herbs.and.Spices.Volume.2.eBook-EEn
Antimicrobial Activity of Basil (Ocimum basilicum) Oil against Salmonella Enteritidis in Vitro and in Food