x

Read HST_CRF_04_02_03.qxd text version

Back

Print

Science Puzzlers, Twisters & Teasers

To jump to a location in this book 1. Click a bookmark on the left. To print a part of the book 1. Click the Print button. 2. When the Print window opens, type in a range of pages to print. The page numbers are displayed in the bar at the bottom of the document. In the example below, "1 of 151" means that the current page is page 1 in a file of 151 pages.

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

The World of Life Science

Listening In

1. Figure out what step in the scientific method the scientists are practicing. Write the name of the step in the blank. a. "Wow! I can't believe how green the grass is over there. Why isn't it brown like on our side of the mountain?"

b. "All right, Nan, flip that switch and cross your fingers."

c. "And that concludes my presentation on the effects of music on mollusk reproduction rates. Are there any questions?"

Copyright © by Holt, Rinehart and Winston. All rights reserved.

d. "Hmmmm . . . If television viewing is important to weasel growth, then weasels who watch less television will not grow as much."

e. "Interesting. My graph of weasel weights shows that weasels that watch sitcoms weigh about 2 kg more!"

f. "The soil is richer where the grass is green. Shall we conclude that the soil is always richer on the other side?"

SCIENCE PUZZLERS, TWISTERS & TEASERS

1

Back

Name _______________________________________________ Date ________________ Class______________

Print

The World of Life Science, continued

Playing Pool

2. Each of these balls represents a different tool for looking at the world. Draw a line from the ball to the correct pocket on the table.

1

Above all, you want a 3-dimensional view of a flea's leg.

2

You want to be able to see that cool DNA strand.

3

You want to see how fast sperm can swim.

4

You think you broke your toes. How can you know?

5

You are curious about who has a cooler-looking brain: you or your friend.

6

You want to count the number of ladybugs on your tomato plants.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

X ray

CT Scan

Scanning electron microscope

5

3

1

6

2

4

Transmission electron microscope

Naked eye

Compound light microscope

2

HOLT SCIENCE AND TECHNOLOGY

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

It's Alive!! Or Is It?

Blocks of Life

1. Sean borrowed his baby sister's blocks to help him prepare for a vocabulary test in biology. He arranged them so that each row of blocks below spells the name of a substance that is a building block of cells. But while he wasn't looking, his sister rotated some of the blocks so that the wrong side is facing toward the front. Choose one letter from each of the blocks in a row to spell the names of some important compounds that are found in cells. Record the names of the compounds on the blanks provided.

L

S R

O D

U I

P N

R O

I

A E

N D

S

a.

C

A

T L

P T

G L

R

V A

I N

S D

P I

R E

I

N

I

L O

E O

C Y

G R

V T

D S

b.

C

D A

B C

H P

U

A E

H L

O I

D T

N L

M P

B T

S

C

c.

D

A E

I

S E

Y

M A

E L

C L

O N

N L

C T

S N

E

E

I S

C R

D B

S

d.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

R U

O P

I

L A

W I

T M

Life: Finding the Right Combination

2. Six words related to the six characteristics of living organisms are hidden in the circle below. Rotate each ring of the circle so that each pie-shaped section of the circle spells one of the words as you read from the outside ring and move toward the inside ring. Write the words on the spaces provided.

C

TAB

HO

UCT

ME

OWT SM

TY

ER

EL

L TA H ION

REP OS ME EDI

S

ROD

G

SCIENCE PUZZLERS, TWISTERS & TEASERS

OLI

SIS

R

H

3

Back

Name _______________________________________________ Date ________________ Class______________

Print

It's Alive!! Or Is It?, continued

The Pathway of Life

3. TULO (The Unidentified Living Organism) has hidden several clues about his identity in a series of true or false questions. Begin with the first statement and decide if it is true or false. If it is true, circle the directions under the True column for that statement. If the statement is false, circle the directions under the False column for that statement. When you have answered all of the questions, follow the directions you have circled and move along the game board. At the end of the game, circle the type of organism that TULO is. Clues a. Plants are decomposers. b. Almost all living organisms are approximately 70 percent water. c. Some animals can get all of the water they need from the food they eat. d. Consumers break down dead organisms and animal waste. e. Oxygen is the only gas found in air. f. Producers make food from carbon dioxide, water, and energy from the sun. g. All organisms require the same amount of space in which to live. h. Most chemical reactions involved in metabolism require water.

Mov e th to Hume an

shMu om ro

True forward 6 back 5 forward 10 back 4 forward 8 back 6 forward 5 back 3

False forward 8 back 1 forward 4 back 2

Copyright © by Holt, Rinehart and Winston. All rights reserved.

forward 9 back 3 forward 2 back 7

Su flowner

TULO starts here

M fo o 2 rw ve sp ard ac es

Hu

Octopus

m an

Move back 3 spaces

E w arth or m

Bea

r

Alga

e

4

HOLT SCIENCE AND TECHNOLOGY

Mov e the to Mos s

Moss

Dog

rm Te

ite

Mi Soil to cro e be ov he om s M t ro sh u M

Fish

ve Mo ard forw aces 2 sp

Bird

ass Gr

Back

Print

Name _______________________________________________ Date ________________ Class ______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Cells: The Basic Units of Life

Endosymbiotic Simulation City

1. Imagine that you are a recognized world expert on cells. Baron Von Dukenheimer is the leader of a medieval walled city, and he needs your help. It seems that someone has told him that his city is about 600 years behind the times. The Baron knows that one of the most spectacular systems in nature is the cell, and he hopes to learn something about organization and production from you, the cell expert. You tell him that the cell is a lot like a city. Help him understand how the parts of a cell work by writing in the appropriate space something you'd find in a city that performs the same function in the cell. Example: endoplasmic reticulum a. vacuole b. nucleus

postal system

c. lysosomes d. ribosomes

Word Connections

Copyright © by Holt, Rinehart and Winston. All rights reserved.

2. Each of the following sentences includes at least one hidden word from the chapter. These words can be found by looking at part of one word and connecting it to the beginning of the next word. For example, the word dog could be hidden in the words Judo games. Circle the hidden words below. a. She speaks to the flock, though neither goose nor gander understand her. b. I love the glockenspiel, though I must say that the organ is my favorite instrument. c. Once llamas have moved in to your neighborhood, it is very difficult to get rid of them. d. Desi's Uncle Otis sued for damages in a court of law.

SCIENCE PUZZLERS, TWISTERS & TEASERS

5

Back

Print

Cells: The Basic Units of Life, continued

Name _______________________________________________ Date ________________ Class______________

Cell Break

3. Harvey Hoodrini is the town's most talented escape artist. For the state fair, Perry Mecium has created a cell that he thinks even Harvey can't break out of. Four walls of the cell use a special combination of letters and numbers to release the locks. Once all four locks are released, they will reveal a message that explains how to get out of the cell. Unscramble the chapter terms surrounding Harvey's cell and write them in the boxes. Vertical words should be written from top to bottom. Then use the letters from the numbered squares to decode the secret message.

h m o b r o s e s i

12 10 5

i

8

m

o

o

n

2

r

i

13

d

4

c

a

t m y

1

7

s a p c l

Copyright © by Holt, Rinehart and Winston. All rights reserved.

9

o t

6

11

3

p

i

x

e

l

g

o

l

o

m

c

g

Phrase: 1 2 3 4 5 6 7 8 9 10 11 12 13

6

HOLT SCIENCE AND TECHNOLOGY

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

The Cell in Action

Fractured Frames

1. Each frame represents a word from the chapter, if you read it in just the right way. Decipher each puzzle and write the answer in the space provided.

Fusion Fusion

taFIRMshun

a. ________________________

b. ________________________

Re +

2. Unravel these symbols to find a word from the chapter.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Solution:

Daffy Definitions

3. The warped definitions below describe some words and/or concepts from the chapter. Place the correct answer in the blank. a. inactive conveyance b. mere in the middle c. the former wife of Mr. O'Cytosis d. the "tation" of hairy males? e. in favor of karyotic corpuscles?

SCIENCE PUZZLERS, TWISTERS & TEASERS

7

Back

Name _______________________________________________ Date ________________ Class______________

Print

The Cell in Action, continued

Chromosome Conundrum

4. The chromosomes below are arranged in a specific pattern. Which of the labeled chromosomes is needed to complete the pattern? Circle the correct choice.

a.

b.

c.

d.

Riddle Poem

5. Which word is described by this riddle poem? The poem describes the word's letters. (Hint: jails and phones) My first is in cars but isn't in bars; My second's in dance, but not in pants; My third is in lame, my fourth is the same. What word could I possibly be?

8

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Heredity

Put on Your Rhyming Genes

1. Fill in the blanks in each of the following rhymes to complete these catchy jingles about heredity. a. With an "X" from my mom Gail And a "Y" from my dad Dale It should be clear that I'm a b. As you surely know from your reading, A pair of dominant or recessive alleles Makes you c. Your genes, indeed, would be tough to steal; Those thieves would be very aggressive They may grab a dominant Though some thieves steal only

The PUNnett Square

2. These puns are bound to make you groan. Fill in the blanks with words from the chapter.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

a. If you have blue , does that mean that you're bound to be sad?

b. Ouch! You just stepped on !

SCIENCE PUZZLERS, TWISTERS & TEASERS

9

Back

Name _______________________________________________ Date ________________ Class______________

Print

Heredity, continued

Will She Get Your Goat?

3. Your goat is about to have a kid. If it is a male, you will randomly select one of these three names to give the kid: Billy, Willy, or Philly. Then you'll ship it off to your aunt Lily. Aunt Lily wants to know how likely it is that she will be sent a Willy. Calculate the probability and fill in the blank with the answer.

Re +

4. Decide what term from the chapter this picture puzzle represents.

Wordy Numbers

Copyright © by Holt, Rinehart and Winston. All rights reserved.

5. Vanity phone numbers are numbers that can be spelled out as easy-to-remember words using the letters on a telephone keypad. For instance, the number 878-6738 can spell the word TRUMPET. What term from the chapter could this number represent?

1 4

ABC

2

DEF

3 6 9

GHI

JKL

5 8 0

MNO

PRS

7

TUV

WXY

*

#

739-2355 (Hint: They're not like the others.)

10

HOLT SCIENCE AND TECHNOLOGY

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Genes and DNA

Green Gene

1. On the planet Dyejob, green hair is a recessive trait. Great Grandma and Great Grandpa Berg both have green hair. So do their three children. They were surprised to find that three of their greatgrandchildren have green hair too, even though all of their grandchildren have black hair. The Bergs concluded that their grandson Bobby must be a carrier of the green hair gene. Shown below is the pedigree of the Berg family. The solid shapes represent the family members with green hair. The pedigree does not show who is a carrier of the gene. Using the pedigree, answer the following questions.

The Bergs

Great Grandma . . . . . . . . .? . . . . . . . . . Great Grandpa

Bunny

Bilbo

Betty

Buffy

Becky

Billy

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Bif

Babs

Bianca

Bess

Bubba

Brooke

Barnie

Bobby

Beth

Buddy

Berta

Beatrice

Basil

Bonnie Blaire

Belle

a. Which, if any, of Bobby's three sisters are carriers of the gene for green hair as well?

b. Beth does not have green hair. Is Beth a carrier? Explain.

c. Bunny, who has blond hair, is a carrier of the green hair gene. She claims to be the long lost child of Great Grandma and Great Grandpa Berg. Should they include her as a daughter in their will? Explain.

SCIENCE PUZZLERS, TWISTERS & TEASERS

11

Back

Name _______________________________________________ Date ________________ Class______________

Print

Genes and DNA, continued

Mutations

2. The original DNA sequence below has undergone 16 substitution mutations. In the spaces below, write the letters of the original bases that have been replaced. Write the letters in the order in which they occur from left to right. Your work will reveal the answer to the question below. original sequence: ACTTTATTCACACTGTCACCTCTATATGCGAAGTG sequence with mutations: ACCTTCGTGTCACGGTGTCCCGTTAATGTGCGGAG What did Ian's mother say when she saw the rat running past Whiskers?

H R

N

H

Word Connections

3. Each of the following sentences contains a hidden word from the chapter. These words can be found by looking at the end of one word somewhere in the sentence and connecting it to the beginning of the next word. Circle the hidden words in each sentence. Example: "Undo" is hidden between the words Run, dog. a. Lulu drinks lemonade nineteen times a week. b. Her version was lengthy; mine was short. c. Sheila buys nothing but brand name clothing.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

d. My mother hoped I greeted the visiting scholar properly.

Crack the Code

4. Use the clues to help you decode the secret message. By substituting the correct word for the coded word in each clue, you will find what each code letter stands for in the secret message. Each letter represents a different letter in the code. Each coded letter represents the same letter throughout the message. You may want to write each word below the code to help you break the code. a. YTDLWE and HKQHB discovered the PWRGOZ helix. b. TPZEQEZ always pairs with DSUAQEZ. Secret message: PET QL DSZ HWPZ WM OQMZ

12

HOLT SCIENCE AND TECHNOLOGY

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

The Evolution of Living Things

Double Trouble

1. Unscramble each of the words below and write it in the blanks. Then rearrange the boxed letters to solve the puzzle. a. Charlie's canine ship b. Breeds only with its own kind c. Left over from a former life d. Distinguishing quality e. Dead, gone, and turned to stone f. The cells' messenger g. An unexpected change

Copyright © by Holt, Rinehart and Winston. All rights reserved.

ABEEGL CEEISSP AEGIILSTV AIRTT FILOSS ADN AIMNOTTU AALNRTU AAADINOPTT

h. Selection done by nature i. Response to change

Answer: (Hint: the theory that holds modern biology together)

Word Circles

2. What is the word coiled inside each of these circles? Words can be spelled clockwise or counterclockwise.

O N E I R A T

a. b.

E G N

E L E

S

N O I

C T

SCIENCE PUZZLERS, TWISTERS & TEASERS

13

Back

Name _______________________________________________ Date ________________ Class______________

Print

The Evolution of Living Things, continued

R S N A O I T

c. d.

E P A

L A V

S

U R V

I

Wordy Numbers

3. Vanity phone numbers are numbers that can be spelled out in easy-to-remember words using the letters on a telephone keypad. For example, 878-6738 can spell TRUMPET. Use the keypad and the company mottoes below to decide which word from the chapter each company uses for its phone number.

1 4

ABC

2

DEF

3 6 9

GHI

JKL

5 8 0

MNO

PRS

TUV

WXY

*

#

a. (837) 844-4251 "A home for unneeded organs"

b. 346-2437 "Your one stop shop for beaks of all kinds"

c. (735) 328-4661 "We'll clean out your gene pool"

d. (773) 242-8466 "Home of the independent response to separation"

14

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

7

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

The History of Life on Earth

Scientific Sleuthing

1. Each of the statements below was made by an organism during the era in which it evolved. Write the correct era in the space provided. The organisms evolved during the following eras: Precambrian, Paleozoic, Mesozoic, or Cenozoic. a. I've seen the greatest swimmers of my generation destroyed.

b. People often accuse me of monkeying around.

c. Oxygen? What is that?

d. Smoke and flames have frightened me ever since the day a large meteorite came crashing into my backyard.

e. My mother had to settle for a potted plant instead of flowers for her birthday.

f. I couldn't find clams on the menu anywhere.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Consonant Tectonics

2. The following sentences about plate tectonics were put through a "word filter" in which all their spaces and vowels were filtered out. What did the sentences say before they were filtered? bt245mllnyrsg,thcntnntswrngntlndmssclldPng.bt180mllnyrsg, Pngbgntdvdnttwpcs.WcllthstwcntnntsLrsndGndwnlnd.rprsntdycntnntsrstllmvng.

SCIENCE PUZZLERS, TWISTERS & TEASERS

15

Back

Name _______________________________________________ Date ________________ Class______________

Print

The History of Life on Earth, continued

Be a Scientific Shakespeare

3. Fill in the blanks below to find out how the world got to be where it is today. If the statement rhymes, it's true. a. The force called evolution began its fateful march when sunlight was changed into carbohydrates and b. Carbon dioxide is expelled by women and men while cyanobacteria give off

text text

.

.

text

c. This O2 gas filled, then bubbled out of the sea and made a layer of ozone, also known as O d. This armor of ozone, like an umbrella on a rainy day, made dry land safe for cells'

text

.

.

Wordy Numbers

4. Vanity phone numbers are phone numbers that can be spelled out in easy-to-remember words. For example, a car dealer might choose the number 289-2277, which can be spelled as BUY CARS. What words from the chapter could the phone numbers below represent? The words in parentheses are clues.

1 4

ABC

2

DEF

3 6 9

GHI

JKL

5 8 0

MNO

PRS

7

TUV

WXY

*

a. 367-7457 (Rockin'!) b. 398-4628 (It's forever.) c. 726-4232 (Massive!) d. (776) 527-9683 (Simple.)

#

e. 774-6283 (Bananas, anyone?) f. 466-4643 (What we are.)

16

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Classification

Classification Riddles

1. You have learned that living things are classified into groups based on genetic similarity. Try to solve the following riddles about real organisms that aren't so easy to classify. a. I have a beak like a bird, And my arms are like snakes. I have more ink than a pen, But I write to confuse. What am I?

b. I have a bill like a duck, But the hair of a mammal. I lay eggs like a bird, But I nurse my young. What am I?

Copyright © by Holt, Rinehart and Winston. All rights reserved.

c. Some take me for a plant, But I don't like the sun. I'm sure not an animal For I'm not on the run. I make bread fuzzy, And I make bread rise. Try to guess my kingdom-- It's quite a surprise. What am I?

SCIENCE PUZZLERS, TWISTERS & TEASERS

17

Back

Name _______________________________________________ Date ________________ Class______________

Print

Classification, continued

Planet of Confusion

2. On the imaginary planet of Molyrhenium, there are four types of life: Gollyhoots, Trungfleppers, Zamzums, and Nelvos. All Gollyhoots are Trungfleppers. Some Trungfleppers are Zamzums. All Zamzums are Nelvos. Which of the following statements must be true? Circle all that apply. (Hint: Try drawing a diagram.) a. Some Gollyhoots are Nelvos. b. Some Zamzums are Gollyhoots. c. All Zamzums are Trungfleppers. d. Some Nelvos are Trungfleppers. e. All Nelvos are Gollyhoots. f. Some Gollyhoots are Zamzums.

Complete the Sequence

3. Find the next two terms in each of the following sequences. a. 1, 4, 9, 16, 25, b. 1, 1, 2, 3, 5, 8, 13, d. S, G, F, O, C,

text text

,

text

text

,

text text

text

c. J, F, M, A, M, J, J, A, S, O, ,

,

text

4. Which word is described by this riddle poem? The poem describes the word's letters. (Hint: But who is the king?) My first is in Austin but isn't in Boston, My second's in pond and also in frond. My third's in the city but not in the street, My fourth's not in steak, but it is found in meat. My fifth and eighth are one and the same, (They're found in the park, the ball, and the game). My sixth is on a flea; my seventh's not in glee, What word could I possibly be?

18

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Riddle Poem

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Bacteria and Viruses

Parallel Puzzles

1. What do all the words in the left column have in common that is not shared by any of the words in the right column? Lyme disease strep throat leprosy tuberculosis a. AIDS flu common cold polio

yogurt cheese buttermilk sour cream b.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

milk pudding cereal orange juice

Riddle Poem

2. Which word is described by the following riddle poem? The lines of the poem describe the word's letters. (Hint: It's a favorite pastime of bacteria.) My first letter's in France, but it's not found in Spain. My second is in delight, though it's also in pain. My third and fourth are not in trouble, but can be found in prison; My fifth is not in fallen, but is certainly in risen. My sixth is in a hole, my seventh in a knoll; What word could I possibly be?

SCIENCE PUZZLERS, TWISTERS & TEASERS

19

Back

Name _______________________________________________ Date ________________ Class______________

Print

Bacteria and Viruses, continued

Word Circles

3. What is the word coiled inside each of these circles? Words can be spelled clockwise or counterclockwise.

C A B

T

E R S I

A I

R

A P E

A

text

T

text

a.

c.

O H T

G

E N M P

I M

Y

T I N

A

text

U

text

b.

d.

Word Connections

4. Each of the following sentences contains a hidden word from the chapter. These words can be found by looking at the end of one word somewhere in the sentence and connecting it to the beginning of the next word. Circle the word hidden in each sentence. Example: The word undo is hidden between the words fun dogs. a. While shopping on Soho Street, Leigh Ann caught a bus. b. The only place in town to see foreign movies is the Morivac cinema.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

20

HOLT SCIENCE AND TECHNOLOGY

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Protists and Fungi

Riddles

1. Try to solve the following riddles based on what you have learned about protists and fungi. a. I sometimes have structures that look like antennae, but I am not an alien. I like to eat, but then again I don't have to. I'm most comfortable among the dead. What am I?

b. I can convert the sun's energy into food, but I am not a plant. Even if you are not mad, I make you see red. I can poison you without ever touching you. What am I?

Copyright © by Holt, Rinehart and Winston. All rights reserved.

c. You have seen me on a pizza, taken me when you are sick, cleaned me off your shower wall, and I've made you scratch your feet. What am I?

The Scientist

2. You are conducting a study on animal-like protists. At the beginning of the study there are 6 amoebas, but 4 die, so 12 more are purchased. Halfway through the study, 3 disappear and 8 more are purchased. Three-quarters of the way through the study, 6 of the amoebas split in half. At the end of the project, the scientist looks in the mirror and lets out a sigh of relief. a. What color are the scientist's eyes?

b. How do you know?

SCIENCE PUZZLERS, TWISTERS & TEASERS

21

Back

Name _______________________________________________ Date ________________ Class______________

Print

Protists and Fungi, continued

Algal Bloom

3. There are 21 swimmers in the ocean, where there are red algae, brown algae, and green algae. Each swimmer sees only one color of algae. Six more swimmers have seen brown algae than have seen red algae. Twice as many swimmers have seen red algae as have seen green algae. Eighteen swimmers have not seen green algae. a. How many swimmers saw red algae? b. How many swimmers saw brown algae? c. How many swimmers saw green algae?

Odd One Out

4. For each group of terms, circle the one that doesn't belong and explain why it doesn't. a. green algae, diatoms, euglenoids, ciliates

b. cilia, pseudopodia, contractile vacuole, flagella

c. mold, water mold, yeast, mushroom

d. malaria, chestnut blight, athlete's foot, Dutch elm disease

22

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Introduction to Plants

"Plant"asy Puzzler

1. Each of the statements below represents the fantasy of a member of one of the main groups of plants. Which of the following types of plants would have each fantasy--an angiosperm, a gymnosperm, or a horsetail? Each plant type can be used only once. a. "I'd like to live in a wet, marshy area. Having a job in the abrasives industry would be suited to my natural gifts."

b. "I want to be the most successful plant in the kingdom. I'd also like to be very colorful so all of the animals will find me attractive."

c. "I'd love to have a large, extended family with a lot of relatives, old and young alike, living all over the world. Pollen is important to me, but I can do without fruit."

Petal Puzzle

Copyright © by Holt, Rinehart and Winston. All rights reserved.

2. Each petal contains a word associated with angiosperms. The letters of each word have been scrambled, and the same letter is missing from each word. Identify the missing letter, and then unscramble the word E P in each petal. T

A

E P S A I I O R F P

S

Missing letter: Word 1:

text text text text text text

O E L P

N

?

E W

T S

Word 2: Word 3: Word 4: Word 5:

SCIENCE PUZZLERS, TWISTERS & TEASERS

23

Back

Name _______________________________________________ Date ________________ Class______________

Print

Introduction to Plants, continued

Hiding in the Tree

3. Five four-letter words associated with trees are hidden in this tree. For each, choose a letter from the ground, then add a letter from each section, in the direction water would flow through the tree. Each letter is used only once. Word 1: Word 2: Word 3: Word 4: Word 5:

text text text text text

F E M N A O S L E O O T S E E

D

T

E C

R

Does Your Plant Knowledge Add Up?

4. Choose a number between 0 and 21 and write it in the first box. Read each statement in order down the list and decide if the statement is true or false. Circle the appropriate mathematical operation for each statement and perform that operation on your number. Place the new value in the box and repeat the procedure with the next statement. After the last statement, you should have your original number. If not, check your math and your plant knowledge! My chosen number: TRUE a. Nonvascular plants tend to be small and live in moist environments. b. Phloem is a vascular tissue that transports water and minerals through a plant. c. The energy that plants use during photosynthesis comes from the sun. d. Guard cells and stomata can be found in the epidermis of leaves. e. Conifers and cycads are two important groups of angiosperms. f. Ancient green algae that lived in the ocean was the ancestor of modern plants. g. Tiny structures known as cotyledons increase the surface area of roots dramatically. h. The stigma, style, and ovary are part of the female reproductive structures of a plant. 9 5 30 2 7 21 8 11 FALSE 7 6 20 3 4 16 3 9

Copyright © by Holt, Rinehart and Winston. All rights reserved.

24

HOLT SCIENCE AND TECHNOLOGY

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Plant Processes

Greg's Gravitropic Greenhouse Gremlins

1. Greg's greenhouse is visited every night by gremlins. These gremlins rearrange his plant pots, either turning them on their right or left sides, or standing them in their normal, upright position. Greg's plants are negatively gravitropic--they grow up. In addition, each day they sprout two leaf buds near the tip. Today is Sunday. Greg sets the plants upright but wonders how the pots were arranged during the past week. Figure out how the pots were lying each day to produce the plant shown. Write right side, upright, or left side in the appropriate spaces. (Hint: the most recent growth is near the tip of the plant.) a. Mon. b. Tues. c. Wed. d. Thurs. e. Fri. f. Sat.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

L

g. Mon. h. Tues. i. Wed. j. Thurs. k. Fri. l. Sat.

R

L

R

SCIENCE PUZZLERS, TWISTERS & TEASERS

25

Back

Name _______________________________________________ Date ________________ Class______________

Print

Plant Processes, continued

Harold's Hothouse Hormones

2. Just down the road from Greg's Greenhouse is Harold's Hothouse. Harold has just received a shipment of plant hormones--auxin and gibberelin. When applied to one side of a plant stem, auxin causes the cells on that side to grow longer. Gibberelin simply causes the entire stem segment to grow longer. He applied these hormones to two of his plants, as shown below. He placed gibberelin on the stem segments labeled G. He placed auxin on the right or left sides of other stem segments as indicated by an A and an arrow. Sketch what his plants will look like after the hormones take effect. a.

G A

Copyright © by Holt, Rinehart and Winston. All rights reserved.

b.

A A

26

HOLT SCIENCE AND TECHNOLOGY

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Animals and Behavior

Complements

1. Unscramble the words in the wheel below. Words opposite each other on the wheel are complementary terms.

b. ______________________ I N T I B O T V ET R P EN A h. ______________________ c. ______________________ E R I R R E R N E N A R T O O g. ______________________ d. ______________________ R V I E A E R V T A I T E T S E f. ______________________ e. ______________________

a. ______________________

N

E

A

A

E

H

B

D

D

Y

P

E

B

Analogies

2. Give the animal-world equivalent to the human items below.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

A

a. perfume b. wearing a suit to the office or the team colors to a football game c. house or bedroom d. compass e. the big red house on the corner or the oak tree across town f. winking, frowning, or nodding your head

text

text text text

text

text

SCIENCE PUZZLERS, TWISTERS & TEASERS

I

E

L

T R

N

T

N

27

Back

Name _______________________________________________ Date ________________ Class______________

Print

Animals and Behavior, continued

Crazy 8's

3. Below are vocabulary words from the chapter that all end with the sound eight. Use the following clues to help you figure out each word. a. "Country lodging"

b. Not low but

text

+

c. French for green +

d. Not yeah, but

text

+

e. Not your, but

text

+ tiger sound

Strange Birds

Copyright © by Holt, Rinehart and Winston. All rights reserved.

4. Almost all rules have exceptions. If the rule has any exceptions, list them in the blanks. If there are no exceptions, write "no exceptions." a. All animals start life as an embryo. b. No animals have cell walls. c. No plants are consumers. d. All animals are active. e. All animals have nuclei.

text text text text text

28

HOLT SCIENCE AND TECHNOLOGY

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Invertebrates

Odd One Out

1. For each group of terms, circle the one that doesn't belong and explain why not. a. earthworm, bristle worm, roundworm, leech

b. dog, sponge, planarian, human

c. lobster, squid, crab, pillbug

d. hydra, clam, sea urchin, centipede

Copyright © by Holt, Rinehart and Winston. All rights reserved.

e. spineless, asymmetrical, invertebrate, without backbone

Analogies

2. In the analogies below, the first word is related to the second word in the same way that the third word is related to a fourth. For instance, the example below can be read, "Lemon is to yellow as lime is to green." Lemons are yellow in color, while limes are green. Fill in the blanks to complete the following analogies. green Example: lemon : yellow :: lime : a. blood vessels : cats :: b. skin : echinoderm :: c. ladybug : 6 :: tarantula : d. ganglia : nervous :: coelom :

text text text text

: mollusks : arthropod

SCIENCE PUZZLERS, TWISTERS & TEASERS

29

Back

Name _______________________________________________ Date ________________ Class______________

Print

Invertebrates, continued

Crack the Code

3. Use the clues to help you decode the secret message. By substituting the correct word for the coded word in each clue, you will find what each code letter stands for in the secret message. Each letter represents a different letter in the code. Each coded letter represents the same letter throughout the message. You may want to write each word below the code to help you break the code. a. Sponges have no LNZZFCWN and no MFKI. b. Slugs and snails eat with a WKIYOK. c. Centipedes and millipedes have a single pair of KBCFBBKF, jaws called ZKBIAEOFL, and a hard MFKI RKVLYOF. d. Roundworms are also called BFZKCSIFL. e. Annelid worms and arthropods have LFJZFBCFI bodies. Secret message: Don't be alarmed, but . . . ABLFRCL KWF FTFWNHMFWF (KOZSLC)

Wordy Numbers

4. Vanity phone numbers are phone numbers that can be spelled out in easy-to-remember words. For example, a car dealer might choose the number 289-2277, which can be spelled as BUY CARS. What word from the chapter could each of these phone numbers represent? The words in parentheses are clues.

1 4

ABC

2

DEF

3 6 9

GHI

JKL

5 8 0

MNO

PRS

7

TUV

WXY

*

a. 467-3287 (Creepy!) b. 665-5875 (Slimy!) c. 776-6437 (Bath buddies.)

#

30

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Fishes, Amphibians, and Reptiles

Chordate Code

1. Use the clue that is given to help you find several terms found in this chapter. Write your answers in the spaces provided. If the phrase: V E R T E B R A T E S A R E C H O R D A T E S is represented as: 3 8 1 6 8 10 1 5 6 8 4 5 1 8 2 20 9 1 7 5 6 8 4 what are the following vertebrate-related terms? a. 18 9 6 9 2 20 9 1 7 b. 6 5 12 14 c. 2 5 1 6 12 14 5 11 8 d. 8 2 6 9 6 20 8 1 15 e. 10 5 2 22 10 9 18 8 f. 4 19 12 18 5 14 2 9 1 7

Scrambled Eggs

2. Below you will find several different reptilian eggs. The reptiles have begun to hatch, so all of the eggs have cracked open. The same letter has been lost out of each one. Unscramble the letters found within each egg and combine them with the missing letter to find what type of reptile is hatching from each egg. Write the names of the reptiles in the spaces provided. The missing letter is: ________

Copyright © by Holt, Rinehart and Winston. All rights reserved.

L

a.

U E T T T O I S O T E

c. b.

O

L TG L A A I

A L D

d.

I

Z

e.

L I D C E O O C

SCIENCE PUZZLERS, TWISTERS & TEASERS

31

Back

Name _______________________________________________ Date ________________ Class______________

Print

Fishes, Amphibians, and Reptiles, continued

Who's Who

3. For each lettered statement below, decide if the statement best describes fishes, amphibians, or reptiles. If the statement describes fishes, place the capital letter in the box labeled Fishes. If the statement best describes amphibians, place the capital letter in the Amphibians box, and so on. Then unscramble the letters in each box to find the name of a reptile, fish, or amphibian. Write the name of the animal on the line beneath the box. a. first vertebrates on Earth (K) b. have a thick dry skin which helps them live on land (E) c. obtain oxygen by gulping air into their lungs or by absorbing it through their skin (D) d. all use lungs to breathe air (U) e. most have a lateral line (A) f. live part of their life in the water and part on land (O) g. thought to be the ancestors of modern birds and mammals (T) h. have three classes: jawless, cartilaginous, and bony (R) i. undergo metamorphosis to change from larval to adult form (T) j. lay eggs surrounded by a shell to protect them from drying out (T) k. most use gills to breathe throughout their life (S) l. live in almost every water environment (H) m. often called ecological indicators due to their sensitivity to air and water pollution (A) n. have stronger, more vertical legs (R) o. eggs contain an amniotic sac filled with amniotic fluid (L) Fishes Amphibians Reptiles

x.

y.

z.

32

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Birds and Mammals

Flying Without a Spare

1. You've borrowed your next-door neighbor's space cruiser to visit a cousin who lives on Mars. But on the way there, one of your engines blows out. The contraption won't fly without all six engines, and now only five work. Your neighbor never keeps a spare and the escape pod appears to be out of whack. Being your resourceful self, you tinker about until you get the escape pod in semi-decent shape. Have you ever driven a rickety old escape pod? Well, it's difficult to steer. You land on various continents on Earth in your search for home. Looking out the porthole, determine-- by what you see--where you've landed. a. 1st landing: You see a large animal--a huge rodent. It must weigh over 70 kg! What is it, and where have you landed?

b. 2nd landing: Immediately after landing, you spot a smaller furry animal. It seems to have small copies of itself hugging onto its belly. The mammal sees you too, and it stops moving. Perhaps it died of fright. What is this creature, and where are you?

Copyright © by Holt, Rinehart and Winston. All rights reserved.

c. 3rd landing: This time you see a flat-nosed, large-eared mammal. You pry open your portal and stick your head out. This animal's breath smells of eucalyptus, like a cough drop. What is it? Where are you?

d. 4th landing: Now something strikes at the glass of the porthole. It's the beak of a large (almost 125 kg!), bad-tempered bird. Its feet look like hooves! What is it?

e. 5th landing: Another bird! This time it's a shy one with soft, hairy feathers and a long, pointed beak. It doesn't look like it does much flying. What bird is this? Where are you?

SCIENCE PUZZLERS, TWISTERS & TEASERS

33

Back

Name _______________________________________________ Date ________________ Class______________

Print

Birds and Mammals, continued

The Wedding Reception

2. Many animals will attend Elephant's wedding reception. His mother is trying to arrange the guests so that each sits next to another animal with whom it shares something in common. In particular, there are four guests who are giving Elephant's mom a headache. Who will sit next to whom? The guests in question are: Spider Monkey--Mrs. Elephant remembers how Spider Monkey embarrassed everyone at Ostrich's picnic last year by insisting on shaking hands. Really, hands! Good gracious! Bat--With all his talk of moving around in the dark, and how those of us with good eyesight are supposedly "missing out," Bat can be such an awful bore! Mole--He means well, Elephant's mom admits, but it is kind of creepy having Mole always smelling you and touching you with his nose. Archaeopteryx--Frankly, everyone is tired of Archaeopteryx's talk of the "good old days." Here are the guests that Elephant's mother can choose from: Swordfish, Manatee, Therapsids, Whale, Platypus, Orangutan. Match one of these guests up with each of our "problem" guests, and explain your choice. a. Spider Monkey:

Copyright © by Holt, Rinehart and Winston. All rights reserved.

b. Bat:

c. Mole:

d. Archaeopteryx:

34

HOLT SCIENCE AND TECHNOLOGY

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Interactions of Living Things

Nature's Philosophers

1. A group of astronauts has discovered amazing new life-forms on a distant moon. Each life-form was asked to describe its philosophy of life in a sentence or two. Help the astronauts categorize each as a producer, carnivore, omnivore, scavenger, or decomposer by writing the appropriate term in the space provided. a. "To kill is wrong. To let food go to waste is worse."

b. "The swift receive the most satisfying reward."

c. "One must lead a balanced life."

d. "Self-reliance is the path to contentment. Always seek the light of truth."

e. "Ashes to ashes; dust to dust."

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Find the Oddball

2. In each group of terms below, three terms are related. Circle the term that doesn't belong and explain why. a. grass, wind, rain, soil

b. salamander, water lily, humidity, bacteria

c. population, community, organism, predator

SCIENCE PUZZLERS, TWISTERS & TEASERS

35

Back

Name _______________________________________________ Date ________________ Class______________

Print

Interactions of Living Things, continued

Soap Opera Symbiosis

3. A new soap opera called Days of Our Life Science is soon to be released worldwide. In this program, the relationships between the characters mirror the interactions of organisms in nature. Close examination of these clips from the first episode will reveal the type of symbiosis each relationship displays. Classify each relationship as mutualism, commensalism, or parasitism. a. Zander: "Before I met you, I was adrift in a sea of despair. And my shoes were always untied. I don't know what I'd do without you." Ashley: "If I didn't have you, my appliances would all still be broken and I would eat only fast food. I love you." Zander and Ashley display .

b. Rodolfo: "I think Suzette is just using me. But, for some reason, I don't really mind." Rodolfo and Suzette display .

c. Rafiq: "When will Sonya realize that I'm not in love with her anymore? And when will she stop borrowing my lawnmower without asking? My lawn is a mess." Rafiq and Sonya display .

Copyright © by Holt, Rinehart and Winston. All rights reserved.

d. Pablo: "Darling, you are everything to me; my sun, my moon, and my stars. You are like a glimmering diamond, shining from a pit of murky ooze. Though I don't know you, all I desire of this world is the chance to gaze upon your angelic face for five minutes." Molly: "Well, okay, as long as I don't have to talk to you." Pablo and Molly display .

Anagram

4. Rearrange the letters from the following words to reveal a fact about a niche. I CAN SAY IF I FLEW A HOE

36

HOLT SCIENCE AND TECHNOLOGY

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Cycles in Nature

Nature is A"maze"ing

1. Six words associated with cycles in nature are hidden in the maze below. Each word contains at least 10 letters. Locate the words by tracing one of the six different paths that lead into and out of the maze. The letters of all of the words occur in order along each path, none of the paths cross one another, and all of the letters are used once and only once to spell the six words. List the words on the lines provided.

M N P C O S E I C D T I T N

Copyright © by Holt, Rinehart and Winston. All rights reserved.

E O N V O O A T M

C

P R O E P I A O P U I

I B S E R I T P S I C R O O U C S

I O T S A A E O T I

I

N S N

N

R

SCIENCE PUZZLERS, TWISTERS & TEASERS

37

Back

Name _______________________________________________ Date ________________ Class______________

Print

Cycles in Nature, continued

Pyramidal Puzzles

2. In each of the pyramids below, only three of the four sides are visible. A set of four related words can be found on each pyramid, one word written at each level. The words are spelled in order as you circle the pyramid, but one letter of each word is hidden on the back side. On the lines provided, list the four words found on each pyramid. List the words in order from top to bottom.

O

M N T S

L IV P AM

A

S

R

E

R

E

O

S

F

D

GR

R

E

b. "

RE

3. A Tom Swifty is a sentence in which the adverb modifying the word said relates to the information in the sentence. An example would be: "My clothes are in tatters," said Tom raggedly. The following are several Tom Swifty sentences related to the cycles of matter. Each is missing a term from the chapter. Write the missing term on the line provided. text a. "Plants use CO2 to make ," said Tom sweetly.

text

is essential to life," said Tom fluidly.

c. "Matter occupies space and has

text

," said Tom heavily.

d. "Coal, oil, and natural gas are

text

," said Tom heatedly.

38

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Tom Swifties

S

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

The Earth's Ecosystems

Eco Tourism

1. You've wandered into a travel agency that offers trips to any ecosystem worth visiting. Inside, you pick up a brochure. Identify the ecosystems described below. a. You'll love the lush growth and busy chatter of countless plants and animals. A must-see for the bug fan in you, and a great winter getaway!

b. Many have described it as a "sea of grass" peppered with wildflowers. Said one visitor, "I hardly even missed the trees!"

c. Fall is paradise here! The colors peak in September and October, so make your reservations before the last leaf drops!

d. Lakes, ponds, and wide open spaces! Come in the summer to see the birds, and remember your boots--it gets soggy!

Copyright © by Holt, Rinehart and Winston. All rights reserved.

e. The breeze through the trees will bring the fresh scent of pine to your tent as you prepare for the morning's hike.

f. Work on your tan while enjoying the beautiful, stark scenery. And don't forget to bring plenty of water along.

Gently Down the Stream

2. Below are what's left of three words that have been mixed up in a raging river. Each word came out of the water as two or more different words. Rearrange the letters to find the original words, which are all features of a river. a. BURY IT RAT b. LET FAR LAW c. READ MEN

SCIENCE PUZZLERS, TWISTERS & TEASERS

39

Back

Name _______________________________________________ Date ________________ Class______________

Print

The Earth's Ecosystems, continued

Under the Sea

3. Rearrange the letters found in each of the forms of marine life below to form words related to marine ecosystems. Write your answers in the blanks. c. a.

d. b.

e.

a. b. e.

c. d.

4. Each clue below will lead you to a word. Sound out the words to find the hidden terms used in the study of land ecosystems. Write the terms in the blanks below. when ice crystals form at night

a.

artificially curly hair

a nickname for mother

b.

to trick or "swindle" someone

What _______? Or: Darned _________ I do, darned _________ I don't.

the oppposite of him

c.

undersea SCUBA explorers

Los Angeles or Dallas, for example

d.

2,000 pounds a. b. c. d.

What kids do with crayons

40

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Sound-Alikes

Back

Print

Name _______________________________________________ Date ________________ Class ______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Environmental Problems and Solutions

Re +

1. Unravel these symbols to reveal words from the chapter.

a.

b.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

c.

Riddle Poem

2. Which word is described by this riddle poem? The poem describes the word's letters. (Hint: Once is not enough!) My My My My My first is in Russia and also Peru. second's in me, but it isn't in you. third is in clay; my fourth one is too. fifth cannot be found in the zoo. sixth and my seventh are both in blue.

Which word am I? I ask you:

SCIENCE PUZZLERS, TWISTERS & TEASERS

41

Back

Print

Environmental Problems and Solutions, continued

Name _______________________________________________ Date ________________ Class______________

Eye Spy

3. Below is a typical school scene. How many good environmental practices can you find? List them below.

42

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Body Organization and Structure

Find the Oddballs and Decode the Message

1. Each group of terms below contains an unrelated oddball. Circle the term that doesn't belong, and explain why it doesn't. Then take out the third letter of each oddball. Rearrange these letters to find the secret code word. a. skin hair nails teeth

b. smooth

flexor

cardiac

skeletal

c. tendon

joint

ligament

cartilage

d. blood formation

Copyright © by Holt, Rinehart and Winston. All rights reserved.

movement

storage

digestion

The Code Within the Code:

text

text

text

text

Think Again

2. The answers to the following riddles all have a second "body conscious" meaning. a. You might hear one at a baseball game or a wedding. b. A seafood sound-alike c. To tease someone d. You hit these right on the head. e. Prisoners live in them.

SCIENCE PUZZLERS, TWISTERS & TEASERS

43

Back

Name _______________________________________________ Date ________________ Class______________

Print

Body Organization and Structure, continued

A Body of Work

3. The figure below was supposed to be labeled with several of the body's organ systems. Unfortunately, the person hired to do the labeling has never heard of an organ system--he just took a wild guess at the placement of the letters. Please help straighten out the mess. Write the correct terms in the blanks.

a.

b.

sc lar ar

a. uvornse

b.

c. d. e. f.

lat

ee

lsk

dia e.

vcu

o

f. setgiveid

c.

d.

m int gu

ruls cum

Build a Better Robot

4. Imagine you have been asked to build a robot that uses many of the same "organ" systems as the human body. You have the following parts available to you. Which system could each part be used for? a. metal pipes b. computer c. various hinges d. rip-proof material e. bungee cords f. electrical wire

44

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

ny re ate

a

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Circulation and Respiration

The Rat Workout

1. Scientists in the cardiovascular research lab at a local university have built two boxes they call the "Rat Workout Boxes." By releasing rewards from small chutes along the sides of the boxes, they encourage the rodents to race from station to station. The rewards are only given if the rats follow the proper sequence from station to station (1­9 for the circulatory workout, 1­7 for the pulmonary workout). The scientists are so familiar with the cardiovascular systems that they have nicknamed each station with one of your vocabulary words. The box called "The Circulatory Workout" begins with the right atrium, then follows the course of a blood cell from there. The box called "The Pulmonary Workout" begins with the nose and follows the course of a molecule of oxygen from there. Your job is to number the stations, then draw lines between them following the sequence. a. The Circulatory Workout right atrium text left atrium text left ventricle text

Copyright © by Holt, Rinehart and Winston. All rights reserved.

text lungs text right ventricle text arteries text capillaries

cells text veins text

b. The Pulmonary Workout nose text bronchi text larynx text bloodstream text

text trachea text bronchioles text pharynx

c. Which workout is the most strenuous for the rats? In other words, which sequence demands that the rats completely cross the box the most times?

SCIENCE PUZZLERS, TWISTERS & TEASERS

45

Back

Name _______________________________________________ Date ________________ Class______________

Print

Circulation and Respiration, continued

Bobby Bebembop's Blood Bank

2. Bobby Bebembop has developed a machine, called the Bloodomatic 3000, that will make 29 L of synthetic blood using 26 L of water and just 3 L of real blood. He is convinced that his new device will put an end to the town's blood shortage. A local hospital has an urgent order for 29 L of synthetic blood that is compatible with blood from type O recipients. He needs 3 L to make a new batch, but there are not 3 L of type O blood. The next blood delivery is not until tomorrow evening, but he still wants to make the urgent batch tonight. He decides to try mixing together at least two varieties of blood, but he has to be sure that the mixture is compatible with type O blood. Bobby found 2 L of type A blood, 2 L of type B, 2 L of type AB, and 1 L of type O. Can he make a batch of synthetic blood compatible with type O blood with what he has now? Explain your answer.

46

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

The Digestive and Urinary Systems

Digestive Disorder

1. In order to study the digestive tract of a 14-year-old human, Professor Martinez shrunk a crew and their vessel to bite size and disguised them as a grape. The ship, however, lost video contact with the professor as soon as it was swallowed. The crew members don't know where they are, but they can use E-mail to describe what they see. Using these E-mail clues, help Professor Martinez track the ship's progress. Message from crew captain: The trip started a bit rough. The crew was a little shaken. We traveled through a long passageway and ended up in a very sloshy room. Right now we are stuck between some sort of door and another long hall.

a. Where are they?

Copyright © by Holt, Rinehart and Winston. All rights reserved.

After the doorway opened more, a big wave of fluid hit us from behind and thrust us forward.

b. What was the fluid?

We are traveling through another hall, longer than the first, but this hall is different. The wall is covered with a hairlike substance. We keep getting squeezed forward. It feels like a boa constrictor keeps squeezing us and then letting us go.

c. Where is the crew now?

d. On a separate sheet of paper, write three more messages the professor might receive from his brave crew, and explain where the crew was when they sent them.

SCIENCE PUZZLERS, TWISTERS & TEASERS

47

Back

Name _______________________________________________ Date ________________ Class______________

Print

The Digestive and Urinary Systems, continued

Anagrams

Solve these anagrams about the digestive and urinary systems. Answers may consist of any number of words. 2. Rearrange the letters from the following words to reveal a fact about saliva. TINY SALMON SEIZE CANVAS

3. Rearrange the letters from the following words to reveal a fact about the gallbladder. DODGE BASEBALL TREE THRILLS

Odd One Out

4. For each group of terms, circle the one that doesn't belong and explain why it doesn't. a. tongue, salivary glands, stomach, kidneys

b. pancreas, molars, incisors, canines

Copyright © by Holt, Rinehart and Winston. All rights reserved.

c. peristalsis, constipation, colon cancer, gastric ulcer

d. urethra, nephron, gastric ulcer, ureter

48

HOLT SCIENCE AND TECHNOLOGY

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Communication and Control

Well, If You Put It That Way . . .

1. Which part of the nervous system is described by each of these alternative definitions? Write the term in the blank. a. Armor of the spinal cord b. Percussion instrument in your head c. Goosebumps of your ice-cream licker d. Electrical wiring of the body

Neuronal Decoding

2. Decode the following neuronal message. The first word is decoded for you as a hint. Jnqvmtft Impulses bsf fmfdusjdbm

Copyright © by Holt, Rinehart and Winston. All rights reserved.

nfttbhft

uibu usbwfm bmpoh

ofvspot.

SCIENCE PUZZLERS, TWISTERS & TEASERS

49

Back

Name _______________________________________________ Date ________________ Class______________

Print

Communication and Control, continued

If Neurons Could Talk . . .

3. You've probably heard the phrases below several times. If these phrases were uttered by neurons, what type of neuron--motor or sensory--would each phrase be spoken by? a. "Hey, don't sweat it." b. "You are so cool!" c. "Shall we dance?" d. "I feel your pain." e. "Go jump in a lake." f. "Here comes the sun."

Wordy Numbers

4. Vanity phone numbers are numbers that can be spelled out as easy-to-remember words using the letters on a telephone keypad. For instance, the number 878-6738 can spell the word TRUMPET. What term from the chapter could each of these numbers represent? Hints are provided.

1 4

ABC

2

DEF

3 6 9

GHI

JKL

5 8 0

MNO

PRS

7

TUV

WXY

*

a. 633-8552 (auto-pilot) c. 467-8573 (e-message)

#

b. 467-6663 (message for you, sir . . .)

50

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Reproduction and Development

Crossing Words

1. The following is a list of first generation words. As they are, the words are nonsense. If you find the right mate for each word, however, they will produce offspring that are vocabulary words from the chapter. Consider the letters in each word to be genetic material. As you have learned from the chapter, parent organisms each contribute one-half of their genes to the offspring. Match each of these words with another from the list that can be divided and recombined in such a way as to produce two vocabulary words. Example: infertation infertile + + menstruile menstruation produce

The Vocabulary Gene Pool

buddidymis fragg pethra egmentation implanenta plactation urenis a.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

embus marseme

epiding monotrupial spote zygerm

fetryo overty testum

pubaries utina + + + + + + + + + + + +

scrotes

vagerus

text text text text text text text text text text text text

spote

text

produce

b.

monotrupial

text

produce

c.

fetryo

text

produce

d.

epiding

text

produce

e.

scrotes

text

produce

f.

pubaries

text

produce

SCIENCE PUZZLERS, TWISTERS & TEASERS

51

Back

Name _______________________________________________ Date ________________ Class______________

Print

Reproduction and Development, continued

g.

implanenta

text

+ + + + + + + +

text text text text text text text text

produce

h.

egmentation

text

produce

i.

vagerus

text

produce

j.

urenis

text

produce

Reproduction Riddles

2. Solve the following riddles about reproduction and development. a. For his diet, Jack gave up all ectothermic animals, poultry, and their products, but he did not give up eggs. What kinds of nests could he have chosen from if he wanted to make an omelet?

c. There is one type of animal that reproduces asexually and cannot survive outside of sea water, yet if you encounter one, it will usually be in fresh water. What is this primitive animal?

Word Connections

3. Each of the following sentences includes at least one hidden word from the chapter. These words can be found by looking at part of one word and connecting it to the beginning of the next word. For example, the word dog could be hidden in the words Judo games. Circle the hidden words below. a. This pen isn't writing very well; maybe it's out of ink. b. Hey bud--dingy whites got you down? Try new Leech Bleach. It sucks the stains right out! c. You want to shake Mars up? I already did that!

52

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

b. Rita feeds her child, though he doesn't yet eat. He moves all around and she feels his heart beat. His eyes are still closed, so he probably can't see. He listens to music. How old can he be?

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Body Defenses and Disease

Typhoid Larry

1. Imagine that you are a pathogen. Your goal in life is to reach the Pathogen Hall of Fame. Starting with Larry's discovery that he is sick, draw a line connecting the infectious opportunities that you could take advantage of. When you reach the Pathogen Hall of Fame, you've succeeded! Movements can only be made vertically or horizontally, not diagonally. END HERE Sharon goes to school. Martha chews on a tennis ball. PATHOGEN HALL OF FAME Martha the sheepdog licks Peter's face. Jan writes in her journal. Ingela writes a letter to John. Scott coughs near Ingela. The coach cancels soccer practice. Peter meets Dan at soccer practice. Dan goes to soccer practice. John sends an E-mail to Dan. Clarice practices the piano.

Patrick sends an E-mail Jan sneezes near her to Sharon. sheepdog, Martha. Jan phones Patrick. Louise reads a book. Louise shares a soda with Jan. Clayton cuts himself and gets blood on Louise.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Ingela boards a plane Ingela cooks dinner for Stockholm. for Clayton, but doesn't wash her hands first. Angie calls Sabrina on the phone. Kevin calls Angie on the phone. Larry takes a nap.

Kevin does his Karen shares her homework with Scott. water bottle with Scott. Larry shakes hands with Kevin. LARRY IS SICK. Kevin sneezes near Karen. Larry takes a shower.

Scott sends an E-mail to Clarice. Karen calls Tim on the phone. Tim eats lunch.

START HERE

SCIENCE PUZZLERS, TWISTERS & TEASERS

53

Back

Name _______________________________________________ Date ________________ Class______________

Print

Body Defenses and Disease, continued

Infection at Trifecta High

2. Imagine you are a scientist at the Centers for Disease Control. The principal from Trifecta High School calls and says a student has come to school on Monday with Triples Disease. She asks how many students will be sick by Friday if nothing is done. Read the entry for Triples Disease from your medical book below and fill in the worksheet to answer the principal's question. Each blank stands for the number of people infected. Triples disease (from Stupendicus Medicus Compendius) This is a disease caused by the Threecillus bacterium, spread by sneezing. Victims become infectious the day after they are infected by the bacteria--after that they can no longer pass on the disease. Each Triples victim will pass the bacteria to three people on the day he or she is infectious. Monday newly infected sick (infectious) sick (post-infectious) Wednesday newly infected sick (infectious) sick (post-infectious) Friday newly infected sick (infectious) sick (post-infectious) j. k. l. d. e. f.

3 1 0

Tuesday newly infected sick (infectious) sick (post-infectious) Thursday newly infected sick (infectious) sick (post-infectious) g.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

a. b. c.

h. i.

Total Number of Sick Students: m.

54

HOLT SCIENCE AND TECHNOLOGY

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Staying Healthy

Mixed-up Inside

1. Each of these puzzles contains two scrambled terms from the chapter. In each case, one of the things can be found in the other. The terms can consist of up to three words. Fill in the blanks with the correct terms. a.

o a c I o T O E C I N b

is in

b.

c N t

s c e x y e d U o p G R c S r a S o A t a m r l b h

are in

c.

o R A O E o

are in

d.

r i p y o I

e P

o O U M t l

a p n p

is in the

Copyright © by Holt, Rinehart and Winston. All rights reserved.

f

L

I C

S

d

e.

l m i t p

a A U J A

n A R I a

h M n e

f.

t e i n M S N I I s o O A D A C p

are in

r

n i

N p d

is in the

SCIENCE PUZZLERS, TWISTERS & TEASERS

55

Back

Name _______________________________________________ Date ________________ Class______________

Print

Staying Healthy, continued

Vitamin Riddles

2. Write the answers to these vitamin riddles in the blanks provided. Each answer is the name of a vitamin. Then arrange the answers to solve the bonus riddle. a. I protect blood cells that are red And without me some enzymes would be dead. b. Healthy are your blood and nerves 'Til I decide to throw some curves. c. Bones and teeth, skin and eyes I help so much I deserve a prize! d. I help the blood when it needs to clot Without me you might bleed a lot. Bonus: Like a mouth But does not speak On squids and birds, It's called a

Wordy Numbers

3. Vanity phone numbers are numbers that can be spelled out using the letters on a telephone keypad. For example, the number 378-6637 can be spelled as DRUMMER. What word from the chapter could each of these numbers represent?

1 4

ABC

2

DEF

3 6 9

GHI

JKL

5 8 0

MNO

PRS

7

TUV

WXY

*

b. 862-2226 (Just avoid it.)

#

a. 623-7489 (Exercise to avoid it.)

56

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Back

Print

Answer Key

Many of the questions in this workbook are open-ended and thus are intended to elicit thoughtful, creative responses. Therefore, in many cases a variety of correct answers are possible and any reasonable answer should be accepted. Suggested answers are provided below for open-ended questions as well as for questions that prompt students for morespecific responses.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

It's Alive!! Or Is It?, p. 3 1. a. proteins b. carbohydrates c. lipids d. nucleic acids 2. reproduction, heredity, metabolism, cells, homeostasis, growth 3. a. F b. T c. T d. F e. F f. T g. F h. T TULO is an earthworm. Cells: The Basic Units of Life, p. 5 1. Sample Answers: a. warehouses or water tower b. Town Hall or library c. police force or junkyard d. factories 2. a. nor gander = organ b. organ is my = organism c. Once llamas = cell d. Otis sued = tissue 3. top: mitochondria, left: ribosomes, right: cytoplasm, bottom: Golgi complex, phrase: The door is open.

Heredity, p. 9 1. a. male c. allele, recessive 2. a. genes 3. 1/2 1/3 1/6 4. Punnett square 5. sex cell

b. true breeding b. mitosis 16.7%

Genes and DNA, p. 11 1. a. Bianca, Bess, and Brooke are carriers. b. Yes, because her children have green hair. c. No, she cannot be a child of theirs, because she does not have green hair. 2. That cat can't catch a rat. 3. a. lemonade nineteen adenine b. lengthy; mine thymine c. brand name DNA d. hoped I greeted pedigree 4. Watson, Crick, double, Adenine, thymine DNA is the code of life. The Evolution of Living Things, p. 13 1. a. Beagle b. species c. vestigial d. trait

SCIENCE PUZZLERS, TWISTERS & TEASERS

57

ANSWER KEY

The World of Life Science, p. 1 1. a. Ask a question. b. Test the hypothesis. c. Communicate results. d. Form a hypothesis. e. Analyze the results. f. Draw conclusions. 2. 1 - scanning electron microscope 2 - transmission electron microscope 3 - compound light microscope 4 - X ray, 5 - CT scan, 6 - naked eye

The Cell in Action, p. 7 1. a. diffusion b. fermentation 2. centromere 3. a. passive transport b. centromere c. exocytosis d. fermentation e. prokaryotic cells 4. d. Each pair appears in each row and appears right side up, sideways, and upside down. 5. cell

Back

e. fossil f. DNA g. mutation h. natural i. adaptation code word evolution 2. a. generation b. selection c. separation d. survival 3. a. vestigial b. finches c. selection d. speciation

Print

2. a. the color of your eyes b. You are the scientist. 3. a. 6 b. 12 c. 3 4. a. All but ciliates are plant-like protists. b. All but contractile vacuole are things that protists use to move. c. All but water mold are fungi. d. All but malaria are diseases caused by fungi. Introduction to Plants, p. 23 1. a. horsetail b. angiosperm c. gymnosperm 2. missing letter: L sepal, pistil, flower, pollen, petals 3. cone, leaf, root, seed, stem 4. a. T b. F c. T d. T e. F f. T g. F h. T Plant Processes, p. 25 1. a. U b. R c. U d. L e. U f. L g. U h. U i. L j. U k. R l. U 2. a. The plant is bent to the left and has a long stem. b. The plant bends first to the right and then upwards. Animals and Behavior, p. 27 1. a. hibernation b. invertebrate c. prey d. innate e. estivation f. vertebrate g. predator h. learned 2. a. pheromones b. camouflage c. territory d. sun/stars; magnetism e. landmark f. communication 3. a. innate b. hibernate c. vertebrate d. navigate e. migrate 4. a. sponge b. no exception c. Venus' flytrap d. sample answer: clam e. no exception Invertebrates, p. 29 1. a. All but roundworms are annelid worms. b. All but sponges have bilateral symmetry. c. All but squids are specific types of crustaceans. d. All but centipedes live in water. e. All but asymmetrical describe lack of a backbone.

The History of Life on Earth, p. 15 1. a. Paleozoic b. Cenozoic c. Precambrian d. Mesozoic e. Paleozoic f. Precambrian 2. About 245 million years ago, the continents were one giant land mass called Pangaea. About 180 million years ago, Pangaea began to divide into two pieces. We call these two continents Laurasia and Gondwanaland. Our present-day continents are still moving. 3. a. starch b. oxygen c. 3 d. DNA 4. a. fossils b. extinct c. Pangaea d. prokaryote e. primate f. hominid Classification, p. 17 1. a. a squid b. a platypus c. a fungus 2. d. 3. a. 36, 49 (perfect squares) b. 21, 34 (Fibonacci sequence) c. N, D (months) d. P, K (levels of classification) 4. animalia Bacteria and Viruses, p. 19 1. a. The terms on the left are all diseases caused by bacteria. b. The foods on the left are all made with bacteria. 2. fission 3. a. bacteria b. pathogen c. parasite d. immunity 4. a. Soho Street host b. Morivac cinema vaccine Protists and Fungi, p. 21 1. a. a slime mold c. a fungus

b. a dinoflagellate

58

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Back

Print

2. a. sinuses b. foot c. 8 d. digestive 3. a. symmetry, head b. radula c. antennae, mandibles, head capsule d. nematodes e. segmented message: Insects are everywhere (almost). 4. a. insects b. mollusk c. sponges

3. a. mutualism b. commensalism c. parasitism d. commensalism 4. A niche is a way of life. Cycles in Nature, p. 37 1. combustion, evaporation, succession, precipitation, respiration, decomposition 2. moss, fern, tree, grass, lake, river, pond, stream 3. a. sugar b. water c. mass d. fuels The Earth's Ecosystems, p. 39 1. a. tropical rain forest b. grassland c. temperate deciduous forest d. tundra e. coniferous forest f. desert 2. a. tributary b. waterfall c. meander 3. a. estuary b. sargassum c. marine d. coral reef e. benthic zone 4. a. permafrost b. conifer c. diversity d. tundra Environmental Problems and Solutions, p. 41 1. a. deforestation b. pollution c. biodiversity 2. recycle 3. containers bearing recycling symbols; a bicycle, skateboard, and roller blades instead of cars; a paper recycling bin; a place marked to collect aluminum cans; metal lunch boxes instead of paper bags; cactus uses less water than grass Body Organization and Structure, p. 43 1. a. Teeth is the only term that is not a part of the integumentary system. b. Flexor is the only term that is not a muscle fiber type. c. Tendon is the only term that is associated with the muscular system. d. Digestion is the only term that is not a function of the skeletal system. A code within the code : gene 2. a. organ b. muscle c. rib d. nail e. cells

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Birds and Mammals, p. 33 1. a. capybara, South America b. opossum, North America c. koala; Australia, New Guinea, or South America d. ostrich, (Africa) e. kiwi, New Zealand 2. a. orangutan, because they both have hands b. whale, because they both use sonar to navigate c. platypus, because it uses its sensitive nose to find food d. therapsids, because they are both extinct Interactions of Living Things, p. 35 1. a. scavenger b. carnivore c. omnivore d. producer e. decomposer 2. a. Grass is the only term that is not an abiotic part of the environment. b. Humidity is the only term that is not a biotic part of the environment. c. Predator is the only term that is not a level of organization in the environment.

SCIENCE PUZZLERS, TWISTERS & TEASERS

59

ANSWER KEY

Fishes, Amphibians, and Reptiles, p. 31 1. a. notochord b. tail c. cartilage d. ectotherm e. backbone f. spinal cord 2. a. turtle b. alligator c. tortoise d. lizard e. crocodile The missing letter is R. 3. a. fishes b. reptiles c. amphibians d. reptiles e. fishes f. amphibians g. reptiles h. fishes i. amphibians j. reptiles k. fishes l. fishes m. amphibians n. reptiles o. reptiles x. shark y. toad z. turtle

Back

3. a. nervous c. integumentary e. cardiovascular 4. a. skeletal c. skeletal e. muscular or skeletal

Print

b. skeletal d. muscular f. digestive b. nervous d. integumentary f. nervous

4. a. medulla c. impulse

b. hormone

Circulation and Respiration, p. 45 1. a. r. atrium, r. ventricle, lungs, l. atrium, l. ventricle, arteries, capillaries, cells, veins b. nose, pharynx, larynx, trachea, bronchi, bronchioles, bloodstream The Pulmonary Workout requires the rat to cross six times; the circulatory only requires four complete crosses. Therefore, the pulmonary workout is more strenuous. 2. Bobby B. will have to wait until tomorrow's delivery to make more blood. Type O recipients produce antibodies to both A, B, and AB red blood cells, so type O blood cannot be mixed with any other blood to be given to a type O recipient. The Digestive and Urinary Systems, p. 47 1. a. They are stuck in the pyloric valve, between the stomach and small intestine. b. The fluid was chyme. c. They are in the small intestine. d. Sample answer Message: We are in a very sloshy, baglike room. The room keeps on squeezing us and we are bathing in two different juices. Answer: They are in the stomach. 2. Saliva contains enzymes. 3. The gallbladder stores bile. 4. a. Kidneys are the only organ not involved in digestion. b. The pancreas is not a tooth like the others. c. They are all problems in the digestive and urinary systems, except peristalsis. d. Gastric ulcer is the only one that is not a tube in the urinary system. Communication and Control, p. 49 1. a. vertebrae b. eardrum c. papillae d. nerves 2. Impulses are electrical messages that travel along neurons. 3. a. motor or sensory b. sensory c. motor d. sensory e. motor f. sensory

Reproduction and Development, p. 51 1. a. spote zygerm produce sperm and zygote b. monotrupial marseme produce monotreme and marsupial c. fetryo embus produce fetus and embryo d. epiding buddidymis produce epididymis and budding e. scrotes testum produce scrotum and testes f. pubaries overty produce puberty and ovaries g. implanenta plactation produce implantation and placenta h. egmentation fragg produce egg and fragmentation i. vagerus utina produce vagina and uterus j. urenis pethra produce urethra and penis 2. a. Jack would have to locate the nest of an echidna or a platypus in order to make an omelet. b. He is a fetus approximately 17 to 25 weeks old. c. The primitive animal is a sponge. 3. a. pen isn't penis b. bud--dingy budding

Copyright © by Holt, Rinehart and Winston. All rights reserved.

c. Mars up? I already

marsupial

Body Defenses and Disease, p. 53 1. up 1, right 1, up 2, left 1, up 3, right 1, up 1 2. a. 9 b. 3 c. 1 d. 27 e. 9 f. 4 g. 81 h. 27 i. 13 j. 243 k. 81 l. 40 m. 364 Staying Healthy, p. 55 1. a. Nicotine is in tobacco. b. Sugars are in complex carbohydrates. c. Calories are in food. d. Opium is in the oriental poppy. e. Marijuana is in the Indian hemp plant. f. Amino acids are in proteins. 2. a. E b. B12 c. A d. K beak 3. a. obesity b. tobacco

60

HOLT SCIENCE AND TECHNOLOGY

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

The World of Earth Science

Re +

1. Decide what term from the chapter this picture puzzle represents.

Solution:

Daffy Definitions

2. The warped definitions below describe different types of Earth scientists. Write the type of scientist to the right of the clue. (Each type can be used more than once.) a. The best are real rock stars. b. These are really deep thinkers.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

c. Their ideas are over most people's heads. d. Their favorite song is "If I Had a Hammer." e. They like it when skateboarders "get some air." f. Cloudy vision is not a problem for them. g. Some of their ideas seem pretty fishy. h. To them, the movie Titanic is a preview. i. They always choose the night shift. j. They are experts on "A galaxy long ago and far away . . ." k. Everyone says these scientists are always wrong.

SCIENCE PUZZLERS, TWISTERS & TEASERS

1

Back

Name _______________________________________________ Date ________________ Class______________

Print

The World of Earth Science, continued

Double Trouble

3. Unscramble each of the words below and write it in the blanks. Then rearrange the boxed letters to solve the puzzle. amount of matter in an object (AMSS) used to measure fluids (second word) (CDEIYLNR) used to measure fluids (first word) (AADDEGRTU) first step of the scientific method (EINOQSTU) what you do with data (AAELNZY) scientific guess (EHHIOPSSTY) last step in the scientific method (ACCEIMMNOTU) used to represent physical things (EDLMO) amount of space something takes up (ELMOUV)

Copyright © by Holt, Rinehart and Winston. All rights reserved.

the first word in the laboratory (AEFSTY) length in SI (EEMRT) (Hint: This is a very large topic in the chapter.)

Paths of Knowledge

4. Starting at one letter, draw a line between it and each of the other letters to spell a word that affects us all. Each letter is used only once.

m E t e s

2

HOLT SCIENCE AND TECHNOLOGY

o

c s y

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Maps as Models of the Earth

Cardinal Directions

1. Winter is coming. Leah and her sister Amber, a pair of North American cardinals, live in Pittsburgh, Pennsylvania and have decided to spend their winter in Savannah, Georgia. This is their first year to migrate, so both could use your help. A translator has written some of the birds' questions for you to answer. a. Leah: I'm holding the compass in front of me with the N facing out, away from me, and the needle is pointing to it. This is magnetic north. I am facing 5 W of what direction?

b. What is the 5 difference called?

c. Leah: I'm holding the compass in front of me with the N facing out, away from me, and the S closest to me. Which letter should the arrow point to--N, S, E, or W--if I want to look south?

Copyright © by Holt, Rinehart and Winston. All rights reserved.

d. Amber: On the map there are horizontal reference lines and vertical reference lines. I know we should be crossing some of these while flying south. What are they called?

e. Leah: I can't hold the compass with my wing while I'm flying. So how can I know that I'm not veering off course or flying in circles?

SCIENCE PUZZLERS, TWISTERS & TEASERS

3

Back

Name _______________________________________________ Date ________________ Class______________

Print

Maps as Models of the Earth, continued

And/Or

2. When the following statements contain an and, combine the answers to the clues to form a term from the chapter. When they contain an or, they describe homonyms, one of which is a term from the chapter. Which term is described? a. someone whose adventures are larger than life, or a list of symbols used in a map

USEFUL TERMS homonyms two words that sound alike but have different meanings

b. When instructions are spoken, they are said to be this, and this is used to weigh pork chops in a meat market.

c. the difference in elevation between the highest and lowest points of the area being mapped, or what you feel after doing well on a test

d. an instrument used to determine direction, and a thornstemmed flower

But Is It Art?

3. As an art project, Amy mapped out her friend Camille's face. To do this, she covered Camille's head with paint and "projected" it onto the inside of a paper cone, with her nose touching the center of the paper. She then opened the cone. Tell what kind of projection she was using, and describe in detail what the print must have looked like.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

4

HOLT SCIENCE AND TECHNOLOGY

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Minerals of the Earth's Crust

Gem Search

1. The names of six common gemstones are scrambled in the gems below. All of the letters spelling a particular gemstone can be found on gems having the same cut. Unscramble the letters on the similar gems to identify the six gemstones and list them on the spaces provided.

Z

I

I

M

A

H

P

D

A

E

N

E

R

Geode Search

2. On a trip to the desert Jermaine and Marissa spend an afternoon hunting for geodes. A geode is a hollow, ball-shaped rock containing an inner cavity lined with crystals. The geodes that contain quartz sell for a dollar, those that contain calcite sell for two dollars, and geodes containing amethyst sell for five dollars. Below are six word-geodes that have a silicate mineral imbedded in them. Use the clues below to "crack open" the geodes and find out who will make the most money when they sell their findings. The first one has been done for you. Marissa a. Where cupid aims his dart . . . b. You'll suffer much guilt if you ruin text your mother's

Copyright © by Holt, Rinehart and Winston. All rights reserved.

.

c. When corn goes "pop" it makes a yummy smell. When this goes "pop" I hope you studied well. Jermaine d. Green is the broccoli flower, while white is the .

R

T

O

A

O

HQUEARARTTZ

CALQUICILTTE

CQUAILCZITE

CAULQUIFLAROWTZER

SCIENCE PUZZLERS, TWISTERS & TEASERS

D

E

B

O

P

D

M

P

A

A

S

L

R

L

Y

P

U

heart

quartz ($1)

5

Back

Name _______________________________________________ Date ________________ Class______________ Minerals of the Earth's Crust, continued

Print

e. Jack be nimble. Jack be

.

AQUIMETHYCSKT AQUARPTPLEZS

f. It's like comparing and oranges.

g. Who had the most profitable day?

Mohs Knows

3. Each of the ten numbers on the Mohs' scale has a characteristic mineral associated with it. Likewise, the names of the minerals can be used to represent the numbers. In this puzzle, you use these numbers to do simple math problems and find the mineral names. In the example below, you must find a seven-letter mineral whose rating on the Mohs' scale, when added to the rating of a four-letter mineral, yields the rating of an eight-letter mineral. The only possible combination is the one shown. For each of the "equations," find the names of the minerals from the Mohs' scale that make the statement correct, and enter these names (one letter per blank) on the lines provided. Example: a. b. 11 c.

C A L C (3) I T E T A L (1) C F L O U R (4) I T E

17

Copyright © by Holt, Rinehart and Winston. All rights reserved.

d. 30 e.

f. 24

g.

16

6

HOLT SCIENCE AND TECHNOLOGY

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Rocks: Mineral Mixtures

Cooking Up Classifications

1. You've entered your geological kitchen. Now you are ready to whip up some recipes involving rocks. Along with the more "usual" ingredients, your cupboards hold the following: calcite, quartz, and feldspar. Decide which recipes you have the proper ingredients for. If you can't make something, explain why not. Can you make . . . a. limestone pie?

b. granite casserole?

c. quartz cookies?

Name that Rock Star

2. Read the biographical sketches of the rock stars in the band below. They have changed a lot through their musical careers. Make up new names for them based on what type of rock they have become.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Sedimentary Sam the String Strummer I melted and cooled. That was so cool I did it some more. Then I weathered and eroded until the heat and pressure got to me. For now, I cannot quite get out of the heat and pressure cycle. a. Matilda the Metamorphic Musician I was a pretty hot rock, but the pressure got to me. So, I melted and cooled for a while in between stints of weathering and eroding. Then I went into a long heat and pressure cycle. But today, I am content just melting and cooling. b. Sonya the Silly Sedimentary Singer I wasn't sure whether or not I liked eroding. So, I went into melting and cooling mode. It was cool being igneous for a while. But since I had never been heated and pressured, I figured I'd give that a try. I'm not sick of it yet. c.

SCIENCE PUZZLERS, TWISTERS & TEASERS

7

Back

Name _______________________________________________ Date ________________ Class______________

Print

Rocks: Mineral Mixtures, continued

Rocky Riddles

3. Solve the following riddles about rocks. a. Finer than conglomerate Coarser than siltstone I am

b. After phyllite Before gneiss I am c. Coarse-grained igneous But not granite I am

d. Farther down than chlorite Heated to temperatures less than garnet I am

Excuse the Interruption

4. Rock formations are hidden in the letters below. Can you unearth them? Fill in the blanks with the hidden terms. (Hint: They cut through rock formations.) RDOICKKEFPOLRUMTAOTNIOBNARTOHCOKLFIOTRHMATION

8

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Energy Resources

Fractured Frames

1. Each frame represents a word from the chapter, if you read it in just the right way. What word or phrase does each puzzle represent?

UbitumS

LLL

a.

b.

FOsmokeG

krypt 91

c.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

d.

fish powered

w r e t a

e.

f.

Daffy Definitions

2. The warped definitions below describe some words from the chapter. Write the correct words to the right of the clues. a. air-powered rotary generator b. ribbon diggings c. relic combustible materials d. crude fumes

SCIENCE PUZZLERS, TWISTERS & TEASERS

9

Back

Name _______________________________________________ Date ________________ Class______________

Print

Energy Resources, continued

Crypto-Math

3. In this puzzle, each digit from 0 to 9 has been assigned a letter based on a word or words from the chapter. Each letter stands for only one digit. Assign the first 10 non-repeated letters of the code word(s), in order, to the digits 0­9. The letters then take the place of digits in arithmetic problems. It is up to you to decipher each problem and find the code word(s). (Hint: Try working backwards; start by unscrambling the code word from the answers to the letter math.) An example: The words WATER POLLUTION are used, with the second T, O, and L dropped. (Any time a letter is repeated, it is dropped.) In this case, the key is now: W 0 A 1 T 2 E 3 R 4 P 5 O 6 L 7 U 8 I 9 I = AW

The simple addition 1

9 = 10 now becomes A

Now for the real problem: A different code word from the chapter has been used to assign letters to the digits. Use the math problems below to find the code word. A I TC Letter Digit I I O OC C N S NN E R R R N R V V S V SV NR OO

text text text text text text text text text text

0

1

2

3

4

5

6

7

8

9

Re +

4. Decipher these symbols to find a word from the chapter.

Solution:

10

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

The Rock and Fossil Record

Anagrams

1. Unscramble the following headlines from a ridiculous newspaper to form terms from the chapter. a. DIRT ROAD ENIGMATIC (Clue: A daughter looks similar to her mother.) R D

b. MICE GET IGLOO (Clue: Slow and steady wins the race.) G T

c. ICE CAVE RAID TODAY (Clue: Reach a stable age.) R D

d. CIA LOST SERF (Clue: It's left behind.) T F

Complete the Sequence

2. Find the next two numbers or letters in each of the following sequences. a. 1, 3, 6, 10, 15,

Copyright © by Holt, Rinehart and Winston. All rights reserved.

, ,

b. Q, T, C, J, T, P, P, M, D, S,

Riddle

3. You may know a girl named after me; Without me stoplights would be tricky. I like to catch bugs, But I have no mouth, arms, or net. I am sometimes terribly sticky. What am I?

SCIENCE PUZZLERS, TWISTERS & TEASERS

11

Back

Name _______________________________________________ Date ________________ Class______________

Print

The Rock and Fossil Record, continued

The Relative Dating Game

4. Jolene and Cletus were looking for cans in their backyard when they found a large hole in the ground. Inside it was a mixed-up pile of fossils that had been excavated by geologists several years ago. Naturally, Jolene and Cletus wanted to find out which fossils were the oldest and which were the most recent. The fossils consisted of a dinosaur, a bumblebee, a passenger pigeon, a giant sloth, and an elephant. The geologists, who apparently liked to play games, left this note in the pile: We have divided our hole into five layers, with layer 1 being the oldest and layer 5 the most recent. In the hole is a pile of five fossils, each of which came from one of the five layers. If you wish to know which fossil belongs to which layer, you must follow these clues: a. The bumblebee was found below layer 3. b. The dinosaur came from an even-numbered level. c. The elephant was found above all the other fossils. d. The pigeon was found in the layer directly above the sloth. e. The sloth was found below level 4 but above the dinosaur.

Use the chart below to help you match each fossil with its layer.

Fossil Order

1 Dinosaur Bumblebee Pigeon Sloth Elephant 2 3 4 5

12

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Plate Tectonics

Tectonic Rhyme Time

1. Professor Bankston, an inventor/architect, has made some creations. Some sound more useful than others. Each of the clues below indicates a two-word rhyming answer that describes one of professor Bankston's creations. Write the words in the blank. a. the amount of force put on a given material, and a machine for applying that force

b. the outermost layer of earth, and oxidation particles that cover the iron portion of it

c. the surface along which rocks break and slide past each other, and an impenetrable room in which to store it

d. extends from the bottom of the mantle to the center of the earth, and the place where you can buy parts of it

Copyright © by Holt, Rinehart and Winston. All rights reserved.

The Blame Game--Whose Fault Is It?

2. Amanda blames others for everything. Below are some questions her teacher has asked her about faults, and the jumbled responses she gave in return. Write the correct responses below. Teacher: Amanda, why did the hanging wall move up relative to the footwall? Amanda: It was Reeser V.'s fault! a. Teacher: O.K. Amanda, let's try again. Why did the hanging wall move down relative to the footwall? Amanda: It was Ron Lam's fault! b.

SCIENCE PUZZLERS, TWISTERS & TEASERS

13

Back

Name _______________________________________________ Date ________________ Class______________

Print

Plate Tectonics, continued

Teacher: One more try, Amanda. This occurred when opposing forces caused rock to break and move horizontally. Amanda: It's not my fault! Petrik Sils did it! c.

Oceanic Plates vs. Continental Plates

3. Little Denny has always wanted to be a sports announcer. Right now, his California neighborhood is experiencing an earthquake and Denny needs a partner to announce the 'quake play-by-play. Fill in the blanks to help Denny. Continental plate and oceanic plate are lined up head to head. Oceanic plate takes the snap. The fields rumble as the crowds go wild. Oceanic plate drops back, away from continental plate. Looks like a pass! Looks like oceanic plate is trying to create a (a.) .

Wait! Continental plate is rushing in. Continental plate has collided with oceanic plate and they are pushing on one another. Continental plate has definitely created a (b.) Oceanic plate isn't finished yet. Oceanic plate moves to the side. Oceanic plate slides past continental plate to create a

Copyright © by Holt, Rinehart and Winston. All rights reserved.

.

(c.)

.

Oceanic plate ducks underneath. Has oceanic plate . . . I think Ocea . . . Yes! Oceanic plate has made it to the asthenosphere and into the (d.) .

Word Connections

4. The following sentence contains a hidden word from the chapter. The word can be found by looking at part (or all) of one word and connecting it to the beginning of the next word(s). Circle the hidden word. For example, the word undo is hidden between the words run, dogs. When Billy goes to the bank, he always gets his money in fives and tens. I, on the other hand, prefer twenties and fifties.

14

HOLT SCIENCE AND TECHNOLOGY

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Earthquakes

Wordquake

1. Professor Punjabi's office has just been shaken by a mighty earthquake. Ironically, he had just finished assembling his six favorite words from the chapter on earthquakes. Now his words are broken into pieces. Can you put them back together? The letters in each cluster cannot be rearranged or broken into pieces.

SE DIV VI HAN GIST U ONQ

MOLO SHIN AKE MO ERG KING MO

ENT

HO

IS

Code Breaker

Copyright © by Holt, Rinehart and Winston. All rights reserved.

2. Use the clues to help you decode the secret message. By substituting the correct word for the coded word in each clue, you will find what each code letter stands for in the secret message. Each letter represents a different letter in the code. Each coded letter represents the same letter throughout the message. You may want to write each word below the code to help you break the code. a. The QDFVJ is always below the PBEFPIGPK. b. JPEJLDYKRBOJ create JPEJLDYKRLJ. c. The YRB OZBDGOPJEJ has nothing to do with teeth or generations. d. Thanks to the RFGESP GPICDI JZJGPL, the building didn't fall to pieces. Secret message: During an earthquake, Bill Haley and the Comets expect things to. . . JORUP, KRGGAP, RIC KDAA!

SCIENCE PUZZLERS, TWISTERS & TEASERS

15

Back

Name _______________________________________________ Date ________________ Class______________

Print

Earthquakes, continued

The Seismic Gap Hypothesis

3. The seismic gap hypothesis can help you determine the probability that an earthquake will occur in a specific region of a fault system. Determine whether each statement below is true or false, and write T or F in the corresponding box in the fault system below. Use this information to determine where along the fault system the next earthquake will be. If you discover a section with three or more "False" answers in a row, you have located a seismic gap! a. Most earthquakes can be felt by humans. b. Earthquakes tend to occur far from plate boundaries. c. Most transform faults produce moderate, shallow quakes. d. Convergent motion occurs where two plates push together. e. Divergent motion creates reverse faults. f. S waves shear rock back and forth. g. The focus is the point on the surface above the epicenter. h. Rigid pipes are less likely to burst than flexible pipes during an earthquake. i. Perishable food is the best thing to pack in an earthquake survival kit. j. The Earth's core is part liquid and part solid. k. Seismic waves last longer on the Earth than on the moon.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Fault System

a. b. c. d. e. f. g. h. i. j. k.

Between what letters are earthquakes most likely to occur?

16

HOLT SCIENCE AND TECHNOLOGY

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Volcanoes

Find the Oddballs and Decode the Message

1. Each group of terms below contains an unrelated oddball. Circle the term that doesn't belong and explain why it doesn't. Then correctly arrange the first letters of all the oddballs to discover a bit of sound advice. a. lapilli aa rock debris

b. pahoehoe

pillow lava

aa

silica

c. volcanic bombs

lapilli

pahoehoe

volcanic ash

d. shield

Copyright © by Holt, Rinehart and Winston. All rights reserved.

crater

composite

cinder

What you would hope to do if you were on a volcanic island that was about to erupt: e ____ ____ ____ ____ e

Think Again

2. The answers to the following clues all have a second "volcanic" meaning. Fill in the correct term. a. Dick and Jane's panting dog. (2 words) b. A grade of eggs. (1 word) c. Circus animals leap through one of these. (3 words)

SCIENCE PUZZLERS, TWISTERS & TEASERS

17

Back

Name _______________________________________________ Date ________________ Class______________

Print

Volcanoes, continued

Eruption!

3. Rearrange the letters found in the erupting volcano below to form words related to volcanoes. Note that one letter has been blown clear of the area and is missing from every one of the jumbled words. Be careful--the missing letter may be used more than once in each word. Write the words in the blanks to the right. a. b. c. d. e. f. g.

Will the Volcano Erupt?

4. Decide whether the following statements are true or false, and put your answers into the prediction chart. If there are three "trues" in a row, you can expect an eruption. a. Eruptions can eject debris and gases at supersonic speeds. b. Some of our largest mountains formed from lava flows. c. Lava that flows onto the Earth's surface is called magma. d. Magma and rock are both pyroclastic materials. e. Silica rich magma is thick and stiff. f. Ash can cause global temperatures to rise. g. A caldera forms when a magma chamber's roof collapses. h. Cinder cone volcanoes erode quickly. i. The Ring of Fire contains nearly 75% of the world's active land volcanoes. Will there be an eruption?

text

18

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

PREDICTION CHART

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Weathering and Soil Formation

Parallel Puzzle

1. What do all of the words in the right column have in common that is not shared by any of the words in the left column? amber contour plowing abrasion sediment air wind water gravity

Soil Anagrams

2. Solve these anagrams about weathering and soil formation. Remember, the answer may consist of any number of words. a. Rearrange the letters in the following words to reveal a fact about topsoil near the equator. SHIP TRIP TOILS LOCATION

Copyright © by Holt, Rinehart and Winston. All rights reserved.

b. Rearrange the letters in the following words to reveal a fact about soil in mild climates. MOIST FIRE REEL TIES PLATE

Decode the Message

3. Decode the following secret message to find out how rocks get worn out. The first two letters are provided as clues. Deudvlrq lv wkh julqglqj ri urfnv wr zhdu grzq hasrvhg vxuidfhv.

Ab

SCIENCE PUZZLERS, TWISTERS & TEASERS

19

Back

Name _______________________________________________ Date ________________ Class______________

Print

Weathering and Soil Formation, continued

Wordy Numbers

4. Vanity phone numbers are numbers that can be spelled out in easy-to-remember words. For example, a car dealer might choose the number 289-2277, which can be spelled as BUY CARS. What word from the chapter could each of the numbers below represent? Hints are provided.

1 4

ABC

2

DEF

3 6 9

GHI

JKL

5 8 0

MNO

PRS

7

TUV

WXY

*

#

a. (423) 933-4464 (Hint: It's a chilly type of mechanical weathering.)

c. 264-6257 (Hint: They contribute to mechanical and chemical weathering.)

d. 542-4367 (Hint: These contribute to chemical weathering.)

e. (699) 436-4766 (Hint: When these two react, chemical weathering occurs.)

20

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

b. 472-8489 (Hint: It's an agent of mechanical weathering.)

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

The Flow of Fresh Water

Map to a Message

Follow the instructions on this worksheet to uncover a hidden message. 1. Use the following clues to fill in the blanks with terms from the chapter. a. Where aeration and saturation zones meet b. When rain rolls into a stream c. A stream follows this d. A measure of the change in elevation over a certain distance e. The downward movement of water through spaces in soil due to gravity f. Basin served by a river system g. Water falling from the sky

Copyright © by Holt, Rinehart and Winston. All rights reserved.

h. How rain gets back up i. Water down under j. Delta on dry land k. Process that can renew the soil l. A rock sandwich with water m. Small contributors to a big river n. When water vapor cools in a cloud

SCIENCE PUZZLERS, TWISTERS & TEASERS

21

Back

Name _______________________________________________ Date ________________ Class______________

Print

The Flow of Fresh Water, continued

o. Underground erosion causes a circular depression p. When cap rock is cracked q. Eventually levels mountains r. Amount of space between rock particles 2. Each of the boxes above should now contain either an N, an S, an E or a W. Use these cardinal directions, in the order in which they appear above, to navigate the grid below. For example, if the first direction is W, you will move one block to the left. If the next direction is N, you will then move one block up, and so on. The letters you connect in this way will reveal a secret message. S I J R T A U N C S K B Y U C I D R G Z O D M V F N Z U M B F E T A H P K U O Y H R N W D E E N P Start Message: C T W L G K B T D O L O L I V E O H A Y P G L M S E W E X U Q E Z B J R U F L Q T A X Q Y X Y I J W

N W S

Copyright © by Holt, Rinehart and Winston. All rights reserved.

E

Re +

3. Which terms from the chapter are these picture puzzles trying to express? Write the term in the blank.

a.

text

b.

text

22

HOLT SCIENCE AND TECHNOLOGY

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Agents of Erosion and Deposition

Shoreline Charades

1. Wave erosion can produce many shoreline features. Use the clues below to identify five of these common features, and list them on the lines provided.

a.

C

S+ +L+ ­

b.

+

c.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

S+ ­H

­N+T ­N

d.

S+

Sand Scramble

2. Particles of sand blown by the wind can collide with rock surfaces and cause erosion. Each sand particle below is about to hit the rock surface. When it does, it will cause one letter to break off the surface. The letter that breaks off, when combined with the letters in the sand particle, will spell a word associated with wind erosion. Find the four words in the sand grains and write them on the lines provided. a. b. c. d. F N T B S b. a. S L O E c. I O N A S R A

N I L SOT A A

d.

O L I T E N A D

SCIENCE PUZZLERS, TWISTERS & TEASERS

23

Back

Name _______________________________________________ Date ________________ Class______________

Print

Agents of Erosion and Deposition, continued

A Whopper of a Wave!

3. In real life, the size of a wave depends on how hard the wind is blowing. In this puzzle, however, the size of the wave will depend on whether the given statements are true or false. Begin with the first statement and decide if it is true or false. If it is true, circle the mathematical expression under the True column and if it is false, circle the mathematical expression under the False column. Then follow the directions that you have circled. When you have finished, the value that you have calculated will be the height of the wave. True a. Desert pavement is commonly formed by water erosion. b. The side of a sand dune facing the wind generally has a steeper slope than the side away from the wind. c. If the angle of a slope is less than the angle of repose, materials on the slope will slide downslope. d. Water, plant roots, and burrowing animals can all contribute to creep. start with 1 meter add 5 False start with 2 meters multiply by 7

subtract 4

add 6

divide by 2

divide by 3

Letter Perfect

4. Each of the following clues describes a letter of the alphabet. When put together, they form a word that can sink great ships. The The The The The The The first is in till and also in drift. second's in cirques but not kettles. third is in shelf and also in sheet. fourth is in base, but it's not found in peak. fifth's in the Andes but not in the Alps. sixth is in horns and in the aretes. seventh is in melting and in calving as well.

What is the word that these letters now spell? Secret word:

24

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

The wave will be

meters tall.

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Exploring the Oceans

Fish Out of Water

1. Before you marches a parade of sea life: cold fish, old fish, odd fish, codfish. They've stormed the steps of our nation's Capitol, demanding an end to the pollution that's killing their ecosystems. Some of them display pictures of loved ones killed by pollution. Generally, it's a non-violent protest. Only occasionally do you see a fish (usually a shark) turn to his neighbor and eat him. The group in front of you suddenly collapses onto the pavement--the land lungs strapped over their wetsuits have given out. Now you must return each to its natural environment, and quickly. Use the clues given to determine which ecological zone each creature calls home. a. Creature #1: It's hard to imagine that this fish is able to see through its small, clouded eyes. The ice packs it wears all over its body may be protecting it from the heat.

b. Creature #2: This odd creature isn't even wearing a land lung. It isn't talking much, because its hard shell is closed tight.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

c. Creature #3: You thought the previous creature was odd, but look at this guy! He looks like eight bullwhips hanging off a balloon. When you get close, he squirts a blue liquid that leaves a stain on your pant leg.

d. Creature #4: Now here's a second fellow without a land lung. His rear fin runs parallel to the ground, rather than perpendicular, and he has a hole at the top of his back. He seems to be trying to say something to you.

e. Creature #5: There's a group of these creatures huddled together. They look like slimy little drinking straws.

SCIENCE PUZZLERS, TWISTERS & TEASERS

25

Back

Name _______________________________________________ Date ________________ Class______________

Print

Exploring the Oceans, continued

Dare to Compare

2. Below you will find paired relationships, or analogies. Use the first pair to deduce the relationship and fill in the blanks. a. Canals are to Mars as ocean floor. b. Plant cells are to trees as clouds. c. Pearls are to oysters as ocean floor. are to the is to are to the

Up on the Scales

3. On the scales of the fish below are letters, and hidden among them are seven terms from the chapter. These terms are spelled out on scales which touch one another, and the same scale can be used more than once. Using the clues provided, trace the paths of the terms. a. they feed from the bottom b. the environment below all others c. they swim freely d. surface floaters e. valley type f. all but the floor g. gave rise to Hawaii

Copyright © by Holt, Rinehart and Winston. All rights reserved.

26

HOLT SCIENCE AND TECHNOLOGY

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

The Movement of Ocean Water

Crossed-Up Words

1. The answer to each of the definitions is already in the right place in this crossword puzzle. Unfortunately, the order of the letters is scrambled. Unscramble the words and write the correct term in the space provided.

1

L

2

I T

3

E S

4

T

F

F

I N S

C

L T

O

5

E

R

E

O

C

I C

S

R F G

7

P

N

W

G

I

L O U

E

L

U

6

I I N

9

A Y

8

M N S M A U U

N I S D W

T

H

R R I N R A A F

O

U

G

T K

Copyright © by Holt, Rinehart and Winston. All rights reserved.

K O

ACROSS

3. worldwide current turner 5. brings nutrients to the surface 8. as low as you can go on a wave 9. shake, rattle, and drown

C N E T

4. keeps the coast "cool"

DOWN

1. saltiness 2. this is why Iceland isn't 6. saved Thor the price of a flight 7. a cause of surface currents

SCIENCE PUZZLERS, TWISTERS & TEASERS

27

Back

Name _______________________________________________ Date ________________ Class______________

Print

The Movement of Ocean Water, continued

Daffy Definitions

2. The definitions below describe some words and concepts from the chapter. Some are trick definitions, while others come from a scientific dictionary. Place the correct word being defind in the blanks to the right. a. unexciting ebb and flood b. superficial maritime flow c. a disturbance in a medium that propagates from one point in a medium to other points without giving the medium as a whole any permanent displacement d. brackishness quotient e. maximum positive displacement of a periodic surfacial disturbance f. abyssal maritime circulation g. a subsurface seaward movement carried up a sloping beach by waves or breakers that is caused by the gravity flow of water

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Fractured Frames

3. Each frame represents a word or concept from the chapter if you read it in just the right way. What word or phrase does each puzzle represent? g n i l l e w tide a. c.

surf's

tide b.

28

HOLT SCIENCE AND TECHNOLOGY

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

The Atmosphere

Some Like It Hot

1. Andrea likes school, but she loves the summer even more. Over the summer, she observed many processes that reminded her of energy concepts she learned about in school. Fill in the energy concepts she has observed in the space provided. Choose from radiation, conduction, convection, greenhouse effect, and global warming. a. Doesn't it seem like lately every summer is the hottest on record?

b. Ouch! The sand is burning my feet! Why didn't I bring my sandals?

c. Ugh! Roll down the window! Next time we should park in the shade. I'm melting back here.

d. This is my favorite part of making soup. See how the spices come up in the middle of the pot then go shooting out to the side and back down? Over and over. That's so cool.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

e. I love to be outside. The sun makes me feel warm all over.

Blow Wind Blow

2. Identify the different types of winds from the clues given below. a. When these winds failed, early traders would give just about anything to get them back.

b. They will take you back home if you're European.

c. They ruffle the penguin's feathers and the polar bear's fur.

d. Airline pilots use these high winds to go with the flow whenever they can.

SCIENCE PUZZLERS, TWISTERS & TEASERS

29

Back

Name _______________________________________________ Date ________________ Class______________

Print

The Atmosphere, continued

Double Puzzle

3. Answer the clues below by filling in the open boxes provided. Then arrange the letters from the highlighted boxes to answer the final riddle. n a. The sun supplies this. b. It's the Earth's sunblock. c. How low (or high) can you go? d. A must for kites. e. It spews from cars and trucks. We wouldn't be here without it: z l i t

We Need a Pollution Solution

4. Rearrange the letters found in the belching smokestack below to form words related to air pollution. Note that one letter--the same letter--is missing from each of the words.

a. b. c.

d. e. f.

HOLT SCIENCE AND TECHNOLOGY

30

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Understanding Weather

Microclimates

1. Decide which two-letter air mass symbol best represents each of the "microclimates" below. The symbols are mP, cP, mT, & cT. Write the appropriate symbol in the space provided. The air mass over . . . a. a steaming cup of tomato soup b. a glass of iced tea c. a hot bubble bath d. a lamp e. an ice cube tray

Poetic Fronts

2. Use the Poetic Precipitation Reporter's poems to classify the following fronts. Assume the air is moving from the left to the right. a. Warm air on the right Cold air on the left There should have been a rainstorm But a cold front caused a theft

Copyright © by Holt, Rinehart and Winston. All rights reserved.

b. Warm air on the left Cold air on the right Brought a little rain And it was warm all night

c. To the right was warm air To the left was cold When I went outside An umbrella I did hold

SCIENCE PUZZLERS, TWISTERS & TEASERS

31

Back

Name _______________________________________________ Date ________________ Class______________

Print

Understanding Weather, continued

Tools of the Trade

3. Connect the dots below to both spell and draw tools of weather science. The first letter is starred. a. b.

*R

E

*W I N

O S D

N

G

A

I

U

A

G CK

c.

d.

T *A O E

*T O M M E

R

M

M N

E

H

ER

T

E ER

e.

M

E

E

R S *P R Y C

O

T

H

32

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Climate

Postcards From ????

1. Your far-traveling friend has been sending you postcards from all over the world. Unfortunately, she bought them all in one country, and mailed them all from another. You'll have to identify each biome she visited based on her descriptions. a. I saw my first kangaroo today! You can see them from the car, hopping across the wide open spaces.

b. It's wet and cool now, but this past summer there were a lot of fires around here. I guess that's normal--the shrubby vegetation is already growing back!

c. Will it ever stop raining?! At least everything is green and lush. And the monkeys are sooooo cute! Miss U!

d. I can't wait to get home. It's muddy here, and the mosquitoes are terrible! Our highlight was a glimpse of a caribou herd.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

e. It's beautiful here. But I made the mistake of touching a cactus, just to see how prickly it was. Doh!

By the Numbers

2. The following "equations" are numbers and phrases important to the study of climate. The letters stand for words. For example, "7 D. of the W." would mean 7 days of the week. What do each of these "equations" mean? a. 0 b. 90 c. 23.5 d. 23.5 L. at the E. L. at the N. and S. P. A. of the E. T. L. of the T. Z.

SCIENCE PUZZLERS, TWISTERS & TEASERS

33

Back

Name _______________________________________________ Date ________________ Class______________

Print

Climate, continued

It's Not the World as We Know It

3. The world, as you know, can be a mixed-up place. On the left, the climates and biomes of the world are scrambled and scattered. Unscramble the terms and write each one on the blank that corresponds to its proper place on the globe.

b. coprilat e. ratiprofectnailors a. eretepmat d. igaat c. rolap

a. b. c. d. e. f.

f. arlachpar

Read Between the Lines

Copyright © by Holt, Rinehart and Winston. All rights reserved.

4. Each of the following short paragraphs hides a word or words associated with climate change. The words have not been scrambled. For example, the word undo is hidden in the words Run, dog. Circle the hidden terms below. a. As you get older, you become more sensitive to the cold. For an older person, a cool shower might feel like ice. Age also slows the body's ability to warm up. b. We are remodeling the upstairs bedroom. The wall surface currently has a rough texture, but we plan to smooth it out with sandpaper. c. We worked out of Grande Fore Station, which overlooked the Saginaw State Forest. For three long, hot, dry months, we scanned the horizon for smoke. d. Traveling can enhance many of the things that you have learned from a book, especially the way things sound or taste or feel. And the further from home you go, the more exotic sensations you will find. So go global. Warm in glowing deserts. Cool in Arctic islands. Taste salt in the ocean air.

34

HOLT SCIENCE AND TECHNOLOGY

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Studying Space

Sky Spy

1. Hidden in the puzzle below are six words associated with finding stars in the night sky. Locate the words by beginning in the middle of the puzzle and working toward the outside. The letters of each word occur in order as you circle clockwise in the puzzle. However, there are many unused letters in the puzzle as well. List the six words on the lines provided.

Z

D

R

Z

E

E

A

O

C

N

L

T

A

N

A

Copyright © by Holt, Rinehart and Winston. All rights reserved.

L

L

T

E

M

C

D

Word Connections

2. Each of the following sentences includes a hidden vocabulary word from the chapter. These words can be found by looking at part of one word and connecting it to the beginning of the next word. For example, dog could be hidden in Judo games. Circle the hidden words below. a. How many dozens in a gross? A dozen I think. b. After peeling the lemon, the lime, and the orange, her hands smelled strongly of citrus. c. In the past Ron O., my partner, never left work undone. d. My winking eye articulated what I could not say aloud.

O

N

I

L

C

E

R

E

D

S

H

T

R

O

P

I

T

I

C

SCIENCE PUZZLERS, TWISTERS & TEASERS

Q

E M

L

L

A

N

O

I

R

U

O

U

T

P

O

I

R

H

T

O

A

T

L

T

L

A

S

P

G

T

R

D

O

N

A

E

N

O

A

L

U

T

I

35

Back

Name _______________________________________________ Date ________________ Class______________

Print

Studying Space, continued

Configuring a Constellation

3. In this puzzle, you will create and identify a common constellation. Begin with the first statement and decide if it is true or false. If it is true, circle the directions under the true column, and vice-versa. When you have completed the statements, follow the directions you have circled and connect the dots in the diagram below. On the line provided, write the name of the constellation you have drawn. TRUE a. A month is the time required for the Earth to revolve once around the sun. start at 5 b. The United States uses the Gregorian calendar. c. The summer solstice is the longest day of the year. d. Our galaxy is referred to as the Milky Way. e. The Hubble Galaxy is the closest major galaxy to our own. f. Most of the stars in a constellation are not near each other in space. g. Most of the stars we see in the night sky are much smaller than the Earth. h. Circumpolar stars can be seen at all times of the year and at all times of night. move to 11 move to 12 move to 9 move to 6 move to 5 move to 4 move to 1

FALSE start at 8 move to 10 move to 4 move to 7 move to 8 move to 3 move to 2 move to 9

Copyright © by Holt, Rinehart and Winston. All rights reserved.

1 3

2 5

7 10 8 11 9 12

6 4

What constellation have you drawn?

36

HOLT SCIENCE AND TECHNOLOGY

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Stars, Galaxies, and the Universe

Fractured Frames

1. Each frame represents a word from the chapter or the name of a star, if you read it in just the right way. What word or phrase does the puzzle represent?

LACK LACK

Procy B

a.

b.

tauALPHAALPHAri

prot star

c.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

d.

knee gas

white white white white white white

e.

f.

Re +

2. Decipher these symbols to find a star name from the chapter.

Solution:

text

SCIENCE PUZZLERS, TWISTERS & TEASERS

37

Back

Name _______________________________________________ Date ________________ Class______________

Print

Stars, Galaxies, and the Universe, continued

Daffy Definitions

3. The warped definitions below describe some words from the chapter. Write the correct words to the right of the clues. a. ebony void b. the conjecture of a vast blast c. chromatic range d. outstandingly new e. ruby jumbo f. two people's astral body maturation plot

Double Trouble

4. Unscramble each word in parentheses and write the resulting chapter term in the blanks provided. Then rearrange the boxed letters to solve the puzzle. a. The universal study: (CGLMOOOSY) b. Most common "star stuff" (DEGHNORY)

Copyright © by Holt, Rinehart and Winston. All rights reserved.

c. A dusty cloud with a case of gas (ABELNU) d. Daystar's name (LOS) e. A color "signature" (CEMPRSTU) f. A blast from the past (ABBEGGHINT) g. It doesn't get any brighter than this (AAQRSU) h. The "real" bright (ABELOSTU) i. Shape of one Milky Way (AILPRS) j. The densest star "stuff" (ENNORTU) k. The color of 4,000 degrees (AEGNOR) Hint: A star's road to maturity:

text

38

HOLT SCIENCE AND TECHNOLOGY

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Formation of the Solar System

Find the Oddballs and Decode the Message

1. Each group of terms below contains an unrelated oddball. Circle the term that doesn't belong and explain why it doesn't. Then arrange the first letters of the oddballs to discover something central to the study of stars and planets. a. mantle orbit crust

core

b. radiative zone

photosphere

crust

sunspot

c. dust

planetesimal

radiative zone

planet

d. ellipse

chromosphere

corona

radiative zone

It's at the center of it all: ____ ____ ____ ____

Sound-Alikes

Copyright © by Holt, Rinehart and Winston. All rights reserved.

2. Each clue below will lead you to a short word. Put the short words together to find the hidden terms, which are used in the study of our solar system. Write the correct terms in the blanks below. a. The shiny metal on the bumper of a car

text " see..."

say can you

The shape of a rubber ball

b. You do this before starting a major project.

text You study for and hope you score well.

text You go to to shop because it has lots of stores.

c. You need one to row a boat.

She was so nervous she fingernails.

text

her

a.

b.

c.

SCIENCE PUZZLERS, TWISTERS & TEASERS

39

Back

Name _______________________________________________ Date ________________ Class______________ Formation of the Solar System, continued

Print

It's All Sort of Nebulous

3. Rearrange the letters found in various parts of the nebula cloud below to form words related to solar system formation. Gravity has pulled some of the letters toward the cloud's center; you may need to use some of these letters to complete each word.

a.

sg x d j a

l

ocu

s t

e.

f.

a. b.

u

v g y i r t b.

c.

c. d. e. f.

e u n b l

d.

k i s

Compute Your Solar System Knowledge

4. Choose a number between 0 and 21 and write it in the first box. Then read each statement, in order, and decide if it is true or false. Circle the appropriate mathematical operation for each statement and perform that operation on your number. Place the new value in the box and repeat the procedure with the next statement. After the last statement, you should have your original number. If not, check your math and your solar system knowledge! My chosen number: a. Particles in a nebula are attracted to one another because of gravity. b. Temperature measures how fast the particles of a substances are moving around. c. Gravity is stronger when objects are far apart. d. 10 million years is pretty fast on a cosmic time scale. e. The motion of the Earth spinning on its axis is called an orbit. f. The motion of the Earth's travel around the sun is called a rotation. g. The gas giants consist of so much gas because of their strong gravity. h. The sun is similar to most of the other stars in our galaxy. TRUE 9 6 20 2 5 12 3 11 FALSE 8 4 30 3 4 21 9 7

Copyright © by Holt, Rinehart and Winston. All rights reserved.

40

HOLT SCIENCE AND TECHNOLOGY

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

A Family of Planets

Planetary Omission Puzzles

1. When combined and rearranged, the missing letters from the alphabets below will spell a word from the chapter. What are the words? BCFGHJKLMNPQUVWXYZ a. ABDFGHIJKLNPQRSUVWXYZ b.

Dr. Emma Nint

2. Dr. Emma Nint has a dream of renaming the planets of our solar system with a more rational, scientific system. She has devised a numerical system for naming the planets, but has not given you a complete list or an explanation of her naming system. Figure out what each set of numbers represents and complete her list. (You'll probably need to refer to your book for help.) The three listed planets are: 1/39.53/2320/p 8/30.06/49528/n

Copyright © by Holt, Rinehart and Winston. All rights reserved.

21/19.19/51118/u Write the names of the other planets in the solar system using the doctor's system.

SCIENCE PUZZLERS, TWISTERS & TEASERS

41

Back

Name _______________________________________________ Date ________________ Class______________

Print

A Family of Planets, continued

Dr. Moonunit

3. Dr. Moonunit sent three exhibits to an astronomy conference. Each arrived in a large truck. The Doctor sent word ahead that one truck would contain an asteroid, one would contain a comet, and one would contain a meteorite. When the trucks arrived, however, they were not labeled. Organizers decided to open the trucks and ask you to identify the contents. On opening the first truck, however, the assembled scientists gasped. The exhibit had apparently been stolen, for the truck contained nothing but a huge puddle of dirty water. The second truck yielded a 7 kilogram rock with a label that read, "Recovered by Antarctic Expedition, 8/11/99." Everyone looked puzzled, except for you. You declared that you did not even need for the third truck to be opened in order to label the three exhibits. How did you label the first, second, and third shipments? Explain.

The Doctors' Debate

Copyright © by Holt, Rinehart and Winston. All rights reserved.

4. Dr. Crudley attended the same conference, and she brought evidence of a newly discovered comet. She had two photographs of what she hoped to name Crudley's Comet. Dr. Arbogast was an orthodontist, not an astronomer, but he was jealous that Crudley's name might be forever associated with a celestial body. Arbogast examined the photographs and declared that Crudley was a fraud. "These aren't even the same comet!" he exclaimed, holding the two photographs up together. Sure enough, the photos revealed one comet with a long, streaming tail and what appeared to be a completely different comet with a short, stubby tail. But, of course, you and the astronomers had a perfectly sound explanation for this. What was your explanation?

42

HOLT SCIENCE AND TECHNOLOGY

Back

Print

Name _______________________________________________ Date ________________ Class______________

SCIENCE PUZZLERS, TWISTERS & TEASERS

Exploring Space

Up There in the Sky

1. There are some important terms orbiting the chapter. Unfortunately, they are so far away that they all seem to blend together. We know that there are three terms with a total of seven words, and thanks to radar we know where the spacing should be. Moving from left to right, stick the following clusters of letters together to discover which terms are orbiting. (Hint: All the letters will be used.) ar ge lo ti os we fi yn ar ci ch th al ro or sa no bi te us t ll or it bi e t a. b. c.

text text text text text text text

Space Probes

2. The Space Probe Hall of Fame has been infiltrated by space probe impersonators. The manager of the hall needs your help catching the impostors. Circle the names of the real space probes below. Galileo Leonardo

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Deep Space 1 Viking I Lunar I Huygens Luna 9 Mars Pathfinder Moondust Hijinks Pioneer 10

Copernicus Venera 9 Cassini Clementine

Stardust S. Grant Lamentine Voyager 1

Mars Range Rover Marinara 10

Keep Probing

3. From the list in puzzle 2, identify the 7 probes that have gone or will go to the outer planets of our solar system.

text text text text

SCIENCE PUZZLERS, TWISTERS & TEASERS

text text text

43

Back

Name _______________________________________________ Date ________________ Class______________

Print

Exploring Space, continued

Space Rhyme Time

4. The following clues come in two parts. The first part describes a space exploration term, and the second part describes a word that rhymes with it. a. to break away from a planet's gravitational pull, and a curtain for it to hide behind

b. the force that accelerates a rocket, and the tiny particles that get blown around in the process

c. a machine that uses escaping gas to move, and a pouch to carry it in

The Laws of Physics

5. Professor Morris has some ideas for launching a rocket. One of her ideas is trying to break the laws of physics. In the spaces, identify each good idea with a chapter term. Beneath any bad ideas, write Breaking the Law. a. Fill a chamber with hot gases that are under very high pressure with no opening for the gases to escape. Make the walls of the chamber exert the same pressure inward that the gases are exerting outward.

b. Release hot gas through a small valve above the exhaust nozzle. Release the gas in one direction out the tail end of the rocket.

c. Attach a chute to the tail of the rocket just below the exhaust nozzle. With the chute, channel the escaping hot gases up the rocket and through an input valve back into the combustion chamber.

d. What law is the bad idea trying to break?

44

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Back

Print

Answer Key

Many of the questions in this workbook are open-ended and thus are intended to elicit thoughtful, creative responses. Therefore, in many cases a variety of correct answers are possible and any reasonable answer should be accepted. Suggested answers are provided below for open-ended questions as well as for questions that prompt students for morespecific responses.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

The World of Earth Science, p. 1 1. dinosaur 2. a. geologists b. oceanographers c. astronomers d. geologists e. meteorologists f. meteorologists g. oceanographers h. oceanographers i. astronomers j. astronomers k. meteorologists 3. a. mass; b. cylinder; c. graduated; d. question; e. analyze; f. hypothesis; g. communicate; h. model; i. volume; j. safety; k. meter; seismosaurus 4. Ecosystem Maps as Models of the Earth, p. 3 1. a. true north b. magnetic declination c. S d. latitude e. by identifying and flying to a reference point 2. a. legend b. verbal scale c. relief d. compass rose 3. Amy used a conic projection. Camille's chin would be at the bottom of the paper, her ears would be on the sides, and her hairline would be at the top. Camille's chin would be

very broad. There would be an arc of no distortion through the middle of her face. Her forehead would be very narrow. Minerals of the Earth's Crust, p. 5 1. diamond, emerald, opal, ruby, sapphire, topaz 2. b. quilt calcite ($2) c. quiz calcite ($2) d. cauliflower quartz ($1) e. quick amethyst ($5) f. apples quartz ($1) Jermaine made more money ($7). 3. a. topaz corundum 17 b. 11 diamond talc c. diamond quartz calcite (or apatite gypsum calcite) d. apatite orthoclase 30 e. topaz / fluorite gypsum f. 24 / fluorite orthoclase g. talc quartz topaz 16 Rocks: Mineral Mixtures, p. 7 1. a. no (need aragonite) b. no (need biotite mica) c. yes 2. a. sample answer: Metamorphic Mike b. sample answer: Igneous Inez c. sample answer: May the Melodious Metamorphic 3. a. sandstone b. schist c. gabbro d. muscovite mica 4. dike, pluton, batholith

SCIENCE PUZZLERS, TWISTERS & TEASERS

45

ANSWER KEY

Back

Energy Resources, p. 9 1. a. bitum in US Bituminous b. few ells Fuels c. smoke in FOG smog d. krypt on 91 krypton-91 e. fish on powered fission powered f. water wheel 2. a. windmill b. strip mines c. fossil fuels d. natural gas 3. conservati[on] 79 99 23 1 1 22 80 100 45 5 6 36 5 6 25 25 36 11 4. lignite The Rock and Fossil Record, p. 11 1. a. radiometric dating b. geologic time c. radioactive decay d. trace fossil 2. a. 21, 28 (Add the number of the position in the sequence to the previous value.) b. O, C (geologic periods) 3. amber 4. Dinosaur: 2 Bumblebee: 1 Pigeon: 4 Sloth: 3 Elephant: 5 Plate Tectonics, p. 13 1. a. stress press b. crust rust c. fault vault d. core store 2. a. reverse fault b. normal fault c. strike-strip fault 3. a. divergent boundary b. convergent boundary

Print

c. transform boundary d. subduction zone 4. tens. I, on tension Earthquakes, p. 15 1. Hanshin, divergent, seismologist, Moho, moonquake, Viking, 2. a. focus, epicenter b. seismographs, seismograms c. gap hypothesis d. active tendon system Shake, rattle, and roll! 3. a. F b. F c. T d. T e. F f. T g. F h. F i. F j. T k. F They are most likely to occur between g and i. Volcanoes, p. 17 1. a. Aa is the only term that is not thrown from an explosive eruption. b. Silica is the only term that is not a form of lava. c. Pahoehoe is the only term that is not a pyroclastic material. d. Crater is the only term that is not a type of volcano. You would hope to escape. 2. a. hot spot b. AA c. Ring of Fire 3. a. lava b. crater c. magma d. lapilli e. caldera f. fallout g. ash 4. a. T b. T c. F d. T e. T f. F g. T h. T i. T The volcano will erupt, based on answers to g, h, i. Weathering and Soil Formation, p. 19 1. The words on the right all name agents of weathering; none of the words on the left do. 2. a. Tropical topsoil is thin. b. Temperate soil is fertile.

46

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Back

Print

3. Abrasion is the grinding of rocks to wear down exposed surfaces. (The alphabet is transposed by three letters.) 4. a. ice wedging b. gravity c. animals d. lichens e. oxygen & iron

Copyright © by Holt, Rinehart and Winston. All rights reserved.

The Flow of Fresh Water, p. 21 1.a. water table b. runoff c. channel d. gradient e. percolation f. drainage basin g. precipitation h. evaporation i. groundwater j. alluvial fan k. deposition l. aquifer m. tributaries n. condensation o. sinkhole p. artesian q. erosion r. porosity 2. You need water to live. 3. a. porosity b. artesian spring Agents of Erosion and Deposition, p. 23 1. a. sea stacks b. headland c. barrier spit d. sandbar 2. a. loess b. saltation c. abrasion d. deflation 3. a. F b. F c. F d. T The wave will be 10 m tall. 4. iceberg

Exploring the Oceans, p. 25 1. a. oceanic zone (anglerfish) b. intertidal or hadal zone (clam) c. bathyal zone (octopus) d. neritic zone (dolphin) e. abyssal zone (tube worms) 2. a. trenches b. water vapor c. nodules 3. a. benthos b. benthic c. nekton d. plankton e. rift f. pelagic g. seamount The Movement of Ocean Water, p. 27 1. 3 across: Coriolis effect 5 across: upwelling 8 across: trough 9 across: tsunami 1 down: salinity 2 down: gulf stream 4 down: California current 6 down: kontiki 7 down: winds 2. a. tidal bore b. surface current c. wave d. salinity e. wave crest f. deep current g. undertow 3. a. surf's up b. high and low tides c. upwelling The Atmosphere, p. 29 1. a. global warming b. conduction c. greenhouse effect d. convection e. radiation

SCIENCE PUZZLERS, TWISTERS & TEASERS

47

ANSWER KEY

Back

2. a. trade winds b. westerlies c. polar easterlies d. jet streams 3. a. energy b. ozone c. altitude d. wind e. exhaust We couldn't be here without it: oxygen 4. a. smog b. soot c. ozone d. smoke e. sulfur oxides f. carbon monoxide

Print

d. taiga (move tropical rainforest here) e. tropical rainforest (move temperate here) f. chaparral (move polar here) 4. a. ice. Age ice age b. surface currently surface current c. Grande Fore Station deforestation d. global. Warm in glowing global warming Studying Space, p. 35 1. equator, pole, zenith, altitude, declination, horizon 2. a. dozen I think zenith b. lemon, the month c. past Ron O., my astronomy d. eye articulated year 3. a. false b. true c. true d. true e. false f. true g. false h. true The constellation is the Big Dipper. Stars, Galaxies, and the Universe, p. 37 1. a. pair of LACKs parallax b. Procy on B Procyon B c. ALPHAs in tauri Alpha Centauri d. prot on star proton star e. knee on gas neon gas f. white dwarves 2. Alpha Centauri 3. a. black hole b. big bang theory c. spectrum d. super nova e. red giant f. H-R diagram 4. a. cosmology b. hydrogen c. nebula d. Sol e. spectrum

Climate, p. 33 1. a. temperate grassland b. chaparral c. tropical rain forest d. tundra e. desert 2. a. 0° latitude at the Equator b. 90° latitude at the North and South Poles c. 23.5° angle of the Earth's tilt d. 23.5° latitude of the Tropical Zone 3. a. temperate (move tropical here) b. tropical (move taiga here) c. polar (move chaparral here)

48

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Understanding Weather, p. 31 1. a. mT b. mP c. mT d. cT e. cP 2. a. occluded b. warm front c. cold front 3. a. rain gauge b. wind sock c. thermometer d. anemometer e. psychrometer

Back

Print

f. the big bang g. quasar h. absolute i. spiral j. neutron k. orange main sequence

Formation of the Solar System, p. 39 1. a. Orbit is the only term that is not a part of the Earth. b. Crust is the only term that is not an part of the sun. c. Radiative zone is the only term that is not part of a planet's formation. d. Ellipse is the only term that is not part of the sun. code word: core 2. a. chromosphere (chrome oh sphere) b. planetesimal (plan a test a mall) c. orbit (oar bit) 3. a. gas b. gravity c. nebula d. disk e. dust f. cloud 4. a. T b. T c. F d. T e. F f. F g. T h. T

Copyright © by Holt, Rinehart and Winston. All rights reserved.

0/.72/12104/v 0/.39/4878/m *The numbers are three different facts about each planet, separated by slash marks. The first number is the number of natural satellites the planet has. The second number represents the planet's distance from the sun in AU. The third is each planet's diameter in kilometers. The letter at the end of each sequence is merely the initial letter of the planet's traditional name. 3. The first shipment was a comet. The second was a meteorite, the third, an asteroid. *The third truck revealed a 5 meter-long chunk of metallic rock. 4. The picture of the long-tailed comet was a picture of what would later be known as Crudley's Comet, taken when the comet was close to the sun. The short-tailed comet was the same comet farther from the sun. Exploring Space, p. 43 1. a. artificial satellite b. geosynchronous orbit c. low Earth orbit 2. circled names: Galileo, Deep Space 1, Viking I, Venera 9, Stardust, Cassini, Huygens, Pioneer 10, Clementine, Luna 9, Voyager 1, Mars Pathfinder, 3. Pioneer 10, Voyager 1, Galileo, Cassini, Huygens 4. a. escape drape b. thrust dust c. rocket pocket 5. a. Newton's third law of motion b. pressure c. breaking the law d. Newton's third law of motion

A Family of Planets, p. 41 1. a. asteroid b. comet 2. 18/9.54/120536/s 16/5.20/142984/j 2/1.52/6794/m 1/1.00/12756/e

SCIENCE PUZZLERS, TWISTERS & TEASERS

49

ANSWER KEY

Back

Name _______________________________________________ Date ________________ Class______________

Print

SCIENCE PUZZLERS, TWISTERS & TEASERS

The World of Physical Science

Fractured Frames

1. Each frame represents a word from the chapter, if you read it in just the right way. Write the answer to the puzzle in the blank.

cyl

inde

r

b.

meter

a.

text

text

Wordy Numbers

2. Vanity phone numbers are numbers that can be spelled out in easy-to-remember words using the letters on a telephone keypad. For example, 878-6738 can spell TRUMPET. Use the keypad and the following company mottoes to decide which word from the chapter each company uses for its phone number.

1

Copyright © by Holt, Rinehart and Winston. All rights reserved.

ABC

2

DEF

3 6 9

GHI

4

JKL

5 8 0

MNO

PRS

7

TUV

WXY

*

#

a. (266) 258-7466 "For the scientist in need of decisions"

b. (497) 684-3747 "Guesses Unlimited"

c. 336-7489 "High or low, we're in the business of matter"

SCIENCE PUZZLERS, TWISTERS & TEASERS

1

Back

Name _______________________________________________ Date ________________ Class______________

Print

The World of Physical Science, continued

The Inside Story

3. Max E. Mumwords and his wife, Minnie, are both scientists at Blah Labs. Max always uses the definition of a word instead of the word itself, a confusing way of speaking that only his wife understands. Nat, who writes the gossip column in the lab newsletter, overhears one of their conversations and wants to write a story about it. Minnie speaks so softly, though, that Nat cannot hear all that she is saying. Help Nat get the scoop by filling in the blanks below with a vocabulary word from the chapter. Max: I read in an amount of space that something occupies of Bell Jar Weekly that only 10% of scientists think green walls make them feel blue. I wonder if that statistic applies to our laboratory? a. Minnie: That

text

is outdated.

Max: Well, even so, it's an interesting unifying explanation for a broad range of hypotheses and observations supported by testing. Our lab has green walls, and I'm blue. b. Minnie: My of your job.

text

is that you are tired

Max: There is no summary of many experimental results and observations that says that you have to like your job. c. Minnie: True, no such

text

exists.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Max: I've thought about quitting the lab and going into the fashion industry. I hear that Socks for Jocks is looking for a sock representation of an object or system. I do have particularly nice ankles. Don't you think? d. Minnie: A job.

text

, now that's a brainy

Max: Well, it happens to be the only job posting in the entire measure of how much surface an object has. e. Minnie: No, Max, there are plenty more jobs in our

text

.

Max: The measure of how hot or cold something is in here seems particularly uncomfortable. I wonder if the AC works. f. Minnie: Yes, the leave.

text

is high. Let's

Max: Yes, let's. The parking basic unit of length in the SI system is running out and we can't afford to get a ticket. g. Minnie: True. I'd hate to run up the

text

.

2

HOLT SCIENCE AND TECHNOLOGY

Back

Name _______________________________________________ Date ________________ Class______________

Print

SCIENCE PUZZLERS, TWISTERS & TEASERS

The Properties of Matter

Let's Go Bowling

1. The 7­10 Splits, a bowling team, won their Tuesday night league championship. To celebrate, they threw a party. Here are some events that occurred during the party. a. Randy, the captain of the bowling team, set up the ten pins in his basement bowling lane and got out his two favorite bowling balls. After a quick spit-polish, his teammate, Nigel, rolled the purple ball down the lane toward the pins. Nigel knocked down all ten pins. He then tossed the green ball to his friend Basil, who tossed it back, declaring, "I never use a green ball on a full moon. It's bad luck." So Nigel tossed him the purple ball. Nigel noted that the green ball was more difficult to throw than the purple ball. Basil noticed that the green ball was more difficult to stop than the purple ball. Both balls are exactly the same size. Why might the purple ball be easier to set into motion and stop moving than the green ball?

Copyright © by Holt, Rinehart and Winston. All rights reserved.

b. For the party, Basil baked a victory cake shaped like a huge bowling ball. On the cake he placed 10 candles, one for each team victory in the championship tournament. The candles burned for 15 minutes before the team blew them out, leaving puddles of wax on top of the cake. What kind of change did the wax undergo?

c. What kind of change occurred with the wick?

d. Basil's enormous cat Binkie ate three large pieces of cake. Bud's tiny dog Booboo ate two. Binkie became sleepy from overeating, so he lay down on the floor to take a nap. Booboo ran laps around the basement at a constant speed, yapping loudly. Booboo had run four laps before he tripped over Binkie and landed on the floor. What stopped Booboo? (circle one) a. Binkie's inertia b. Binkie's momentum c. Booboo's inertia d. Booboo's momentum

SCIENCE PUZZLERS, TWISTERS & TEASERS

3

Back

Name _______________________________________________ Date ________________ Class______________

Print

The Properties of Matter, continued

Weight Is . . .

2. Professor Anastasio has written some statements for his students to help them understand weight. Unfortunately, the statements are more confusing than they need to be. What is each phrase really trying to say about weight? a. a calculation of the attractional pressure on a directive.

b. varied depending on where the object is in relation to the third stone from the sun (or any other corpulent headless mass in the universe).

c. calculated with a rainy season's fish armor.

d. spoken in fig cookies.

Mass Is . . .

3. Professor Anastasio's student Jon has tried to help his poor teacher. Regrettably, Jon is more mixed up than his professor. He has mistakenly replaced some of the key words in these statements about mass with words that sound similar but make the statements gibberish. Provide the correct terms in the blanks below the statements. a. a pleasure of the amount of clutter in an inject.

b. always consent for a reject no matter where the reject is in the poetic verse.

c. espresso in kilography, graham crackers, and minigraham crackers.

4

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Back

Name _______________________________________________ Date ________________ Class______________

Print

SCIENCE PUZZLERS, TWISTERS & TEASERS

States of Matter

Mystery Jars

1. The labels have fallen off three jars in the chemistry lab. Jill, Jess, and Juan are each holding a jar. One jar contains a solid, another jar contains a liquid, and the third jar contains a gas. They know that the substances contained in the jars are nitrogen monoxide, silicon dioxide, and hydrogen hydroxide. Use the clues provided below to match the jars with their contents and the students holding them. Then, in the space provided below, write the new label that describes the contents and identifies who last handled the jar. The grid provided below may help you organize the information and solve the puzzle. Clues: · Juan is not holding jar C, nor does he have the solid. · Silicon dioxide is not a liquid, and it is not in jar B. · Nitrogen monoxide is a gas. · Jar A does not contain a gas, and it is not being held by Jill. · The jar Jess is holding is not marked with a C, nor does it contain hydrogen hydroxide. · The liquid is not in jar A. · Neither Jess nor Jill have the gas. Place an X in the box if the descriptions belong to the same jar. Place an O in the box if the descriptions belong to different jars. A nitrogen monoxide silicon dioxide hydrogen hydroxide solid liquid gas Jill Jess Juan Labels: a. Jar A b. Jar B c. Jar C

SCIENCE PUZZLERS, TWISTERS & TEASERS

Copyright © by Holt, Rinehart and Winston. All rights reserved.

B

C

Jill

Jess

Juan

solid liquid

gas

5

Back

Name _______________________________________________ Date ________________ Class______________

Print

States of Matter, continued

What's The Matter?

2. Four words associated with matter will fill the boxes below. The letter for each individual box is one of two choices, indicated by the codes above and below the boxes. The codes lead you to a letter in the 5 5 grid below. For example, the first letter could be either T or P. Circle the appropriate letter in each box to spell four matter-related words.

C3 A3 E2 D4 C3 E2 C5 C2 A2 D2 C2 A3 B1 A1 B3 A2 C2 E4 B2 B3

E4 A1 C2 A2 A5 D5

C3 E2 C4

A3 E1 D3 E3 E1 C5

A5 E2 A3 E1 C1

A 1 2 3 4 5

B

C

D

E

R U Y F I S E O J A L D T Q H C Z N W P M V G B K

Venn Diagram Scramblers

Copyright © by Holt, Rinehart and Winston. All rights reserved.

3. Each Venn diagram contains three words associated with states of matter. The letters of the words have been scrambled, and some of the letters are common between more than one word. Unscramble the letters of each word, being sure to include the letters that are also common to one or both of the other words. Write the names of the three words for each Venn diagram in the space provided.

O D N L N E E T M O V R Z P A I M E O I N A T S B U

O I G Z F R I

B

C N L

text text text

text text text

6

HOLT SCIENCE AND TECHNOLOGY

Back

Name _______________________________________________ Date ________________ Class______________

Print

SCIENCE PUZZLERS, TWISTERS & TEASERS

Elements, Compounds, and Mixtures

I Am Not a Metalloid

1. Professor Medeski, the mad scientist, wants to create an army of metalloids to take over the world. He has made a number of prototypes and named them after his friends. Professor Medeski must now test the prototypes. Based on each test result, help Professor Medeski identify (in the spaces below) his creations as metal, nonmetal, or metalloid. a. Carrie is difficult to shape, and when struck with an anvil she shatters.

b. Tom is shiny and easy to shape, but when dropped into water he rusts.

c. Lydia is shiny and may by hammered into a thin sheet or drawn into a small wire, but when thrown in the fire she gets hot too quickly.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

d. Pete is dull in appearance, but when mixed with silicon he becomes a working computer chip.

e. Molly fills whatever container she occupies, but when thrown in the fire she is slow to react.

f. Chia has a shiny surface, and when mixed with others she becomes a good conductor.

SCIENCE PUZZLERS, TWISTERS & TEASERS

7

Back

Name _______________________________________________ Date ________________ Class______________

Print

Elements, Compounds, and Mixtures, continued

Alloys or Allies

2. The words on the left are all descriptive terms for one of the words on the right. Circle the word that makes the best ally. concentrated dilute saturated solution compound element

Ordered Squares

3. Each of the three squares below contains an eight-letter word related to the periodic table. The letters of each word are arranged in order in the square when you move either clockwise or counterclockwise. Write the words on the lines beneath the squares. P O U a. N M O C D b. N O N L M E T A c. U R E S T X I M

Mixtures

Copyright © by Holt, Rinehart and Winston. All rights reserved.

4. Each of the following clues contains an anagram for a process or tool used to separate mixtures. The letters of the anagrams are in italics. Rearrange the letters in italics and write the answer in the blank. a. To attract them with one of these, you may need heavy iron plates to tag men. (tool)

b. You may need to relift a component with a beaker or a wheelbarrow, depending on how much compound you pass through one of these. (tool)

c. After doing this to purify water at the Bunsen burner station, some people like to add dill for flavor--I know I do. (process)

8

HOLT SCIENCE AND TECHNOLOGY

Back

Name _______________________________________________ Date ________________ Class______________

Print

SCIENCE PUZZLERS, TWISTERS & TEASERS

Matter and Motion

Daffy Definitions

1. Below are some really silly definitions for words found in the chapter. The number after each word shows the number of letters in the answer. See how many you can solve! a. A very weighty subject (7) b. Opposite of a lubrican (9) c. Web propulsion (8) d. Roman "five," low metropolis (8) e. Presently falling forward, also forces (10) f. The weight of 2,000 frics (8) g. Playground pastime; type of friction (7) h. 2000 pounds never seen before (6)

A-maze-ing

Copyright © by Holt, Rinehart and Winston. All rights reserved.

2. Follow the maze below in the proper order to spell out a word from the chapter.

Start

Finish

word:

SCIENCE PUZZLERS, TWISTERS & TEASERS

9

Back

Name _______________________________________________ Date ________________ Class______________

Print

Matter and Motion, continued

Riddles

3. Solve the following riddles about terms from the chapter. a. When the reference point looks for me, I'm not where I used to be. I'm fast and I'm slow, I'm there whenever you go. What am I?

b. On just two things I depend: How long I took and where I've been; Some confuse me with velocity, Though it is not the same as me (Well, not exactly). What am I?

d. I'm often quite strong (I do rhyme with horse); The unit I use Is Newtons, of course! What am I?

10

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

c. From dirt on the road To water in the ocean, I'm a force that opposes motion. What am I?

Back

Name _______________________________________________ Date ________________ Class______________

Print

SCIENCE PUZZLERS, TWISTERS & TEASERS

Forces in Motion

Letter Comet

1. Commander Eileen Collins was playing Scrabble® with her fourman crew on board the KC-135. In this game, new words are formed by adding wooden tiles, each with a letter and a point value, to a board. Each word must share at least one letter with the word it crosses. The numbers on the tiles are added to find the score for each word. When the crew of the KC-135 play, they use only words from their favorite chapter, "Forces in Motion." Just after Commander Collins spelled centripetal on the board, the KC-135 tipped downward, throwing many of the tiles into free fall. Only the tiles that were sticky from yesterday's orange-juice spill didn't fly off. Help them figure out where the other tiles belong. (Each tile is used only once.) Write the correct letters on the board.

O N

1

O T

1

E U

1

T N

1

R F

1

M R

3

R E

1

A S

1

E P

1

W A

4

1

1

1

1

4

1

1

1

3

1

S

1

M

Copyright © by Holt, Rinehart and Winston. All rights reserved.

3

I N C E

3

1 1 1

N T O

1 1

1

M A

3

1

C E

3

1

I

1

T

1

L

1

Pilot Jeffrey Ashby remembered that his score was 10 but forgot the word he'd spelled during his only turn. Which word did he spell?

SCIENCE PUZZLERS, TWISTERS & TEASERS

11

Back

Name _______________________________________________ Date ________________ Class______________

Print

Forces in Motion, continued

Nature Poems

2. Below are four poems that represent four terms from the chapter. Read the poem and decide which word it best represents, then write the correct term under the poem that describes it. Terms: momentum, orbit, action/reaction forces, projectile motion golf ball desiring the air still you fall quickly loving the Earth a. for the quarterback the tackle's only gift waits unwanted c. the universe offers itself the moon's face hides from what it cannot have b. the man pushes a cart pushing the man the mountain sleeps d.

Can't We All Just Get Along?

3. Five types of forces in motion have applied to rent one house. Two of them, however, refuse to live in the same room. Which two refuse to share a room? Explain.

12

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Back

Name _______________________________________________ Date ________________ Class______________

Print

SCIENCE PUZZLERS, TWISTERS & TEASERS

Forces in Fluids

Under Pressure

1. Becky Beaker has a very adventurous robot. To keep track of her roaming robot, she has attached a device that will measure atmospheric pressure. The table at the bottom of this page indicates the approximate pressure of air at various locations where her robot might be found. Using the questions below, you can determine the atmospheric pressure where Becky's robot is currently located. Begin with the first statement and decide if it is true or false. Then circle the mathematical expression under the correct column. Then follow the directions that you have circled. The atmospheric pressure you end up with will guide you to the robot. True a. Liquids are fluids, but gases are not. b. Liquids generally cannot be compressed as much as gases, making liquids ideal in hydraulic systems. c. Water exerts greater pressure than air.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

False start with 2 kPa add 6

start with 3 kPa multiply by 12

add 3 subtract 8 add 1

divide by 3 multiply by 11 divide by 9

d. The upward force on an airplane is called thrust. e. Objects that are less dense than water tend to sink when placed in water. Location

Atmospheric pressure 0 kPa 20 kPa 33 kPa 51 kPa 101 kPa

orbiting the Earth in a space shuttle flying a jet plane hiking at the top of Mt. Everest driving through downtown La Paz, Bolivia making sand castles at the beach Where is Becky's robot?

SCIENCE PUZZLERS, TWISTERS & TEASERS

13

Back

Name _______________________________________________ Date ________________ Class______________

Print

Forces in Fluids, continued

Spilled Shipment!

2. Three crates of balls from Ball, Inc. were accidentally dropped into a lake near the factory. Fortunately, Ball, Inc. packages all of its products in water-tight crates so none of the goods will be damaged. However, the company doesn't keep very good records, so the following information is all that is available. Of the crates that were dropped in the lake, one was blue, one was red, and one was tan. They were also labeled A, B, and C. The crates had different densities (0.5 g/cm3, 1.0 g/cm3, and 1.5 g/cm3) and contained different equipment (soccer balls, golf balls, and tennis balls). You must use the clues provided below to match the crates with their contents and densities. The grid provided may help you to organize the information and solve the puzzle. Clues: · · · · · · · · Crate A does not have the greatest density, nor is it red. The soccer balls are not in crate B. The density of crate B is less than the density of crate C. The crate containing golf balls is not blue. The crate with the greatest density does not contain soccer balls. Crate A is tan, but there are no tennis balls in it. Crate B is not red. The crate having the lowest density contains the tennis balls.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Place an X in the box if the descriptions belong to the same crate. Place an O in the box if the descriptions belong to different crates. A 0.5 g/cm 1.0 g/cm3 1.5 g/cm3 soccer golf tennis blue red tan

3

B

C

blue

red

tan

soccer

golf

tennis

a. Crate A b. Crate B c. Crate C

14

HOLT SCIENCE AND TECHNOLOGY

Back

Name _______________________________________________ Date ________________ Class______________

Print

SCIENCE PUZZLERS, TWISTERS & TEASERS

Work and Machines

Parallel Puzzle

1. What do all the words in the left column have in common that is not shared by any of the words in the right column? ramp screw chisel doorstop hammer faucet axle hinge

Wheel Puzzle

2. The wheels of this machine are identical. They all have an outer circumference of 10 cm and an inner shaft circumference of 5 cm. If the crank is rotated one quarter turn counterclockwise, where will the clock's hand point?

Copyright © by Holt, Rinehart and Winston. All rights reserved.

11 12 1 2 10 9 3 4 8 7 6 5

SCIENCE PUZZLERS, TWISTERS & TEASERS

15

Back

Name _______________________________________________ Date ________________ Class______________

Print

Work and Machines, continued

Wordy Numbers

3. Vanity phone numbers are numbers which can be spelled out in easy-to-remember words. For example, a car dealer might choose the number 289-2277, which can be spelled as BUY CARS. What word from the chapter could each of the numbers below represent?

1 4

ABC

2

DEF

3 6 9

GHI

JKL

5 8 0

MNO

PRS

7

TUV

WXY

*

#

a. 785-5397 (the wheel deal)

b. 639-8667 (apple dodger)

c. 622-4463 (let it do the work)

Copyright © by Holt, Rinehart and Winston. All rights reserved.

d. 385-2786 (an important point)

e. (333) 424-3629 (friction gets in its way)

Anagrams

4. Rearrange the letters from the following words to reveal a fact about force. FOX ENTERS PINE DEN CROSSWISE

5. Rearrange these letters to reveal a fact about work. DOMESTIC RICE SKIN SOFTWARE

16

HOLT SCIENCE AND TECHNOLOGY

Back

Name _______________________________________________ Date ________________ Class______________

Print

SCIENCE PUZZLERS, TWISTERS & TEASERS

Energy and Energy Resources

When They Were in the 8th Grade (Tall Tales)

1. When they were in the 8th grade, some famous scientists and inventors had some strange ideas about various types of energy. From the clues, identify the types of energy and write them in the blanks. a. Sir Isaac Newton wanted to invent an air conditioner for birds. He constructed a fanlike device and pointed it at the apple tree where his favorite birds perched. The fan converted the energy of the apples in the tree into energy, and they fell on Newton's head. And now we have a theory of gravity. b. Robert Oppenheimer wanted to make water lighter so that his pack would weigh less when he went hiking. He decided to do this by splitting the hydrogen atom (of which there are two per each water molecule) in half. The result was a large explosion caused by a chain reaction. The energy produced was energy. c. Albert Einstein wanted to measure the intensity of the light from Alpha Centauri, the star closest to the Earth after our sun. He knew that once the vibrations of electrically charged particles left Alpha Centauri it would take the energy about four years to reach his telescope. His anticipation made each year seem like a decade. From this he developed the theory of relativity.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Word Connections

2. Each of the following sentences contains a hidden word from the chapter. These words can be found by looking at part of one word somewhere in the sentence and connecting it to the beginning of the next word(s). For example, the word undo could be hidden between the words run, dogs. Circle the hidden word in each example. a. Don't ask me, Chan. I calibrated the other sphygmomanometers. b. Man, these peppers are potent! I already can't feel my tongue! c. These are sour celery drops, a fabulous candy I just invented.

SCIENCE PUZZLERS, TWISTERS & TEASERS

17

Back

Name _______________________________________________ Date ________________ Class______________

Print

Energy and Energy Resources, continued

Renewable Alphabet

3. Some energy resources can be used and then replaced in nature over a short period of time. Below is a list of letters. Beside each letter is a number designating the amount of times you can use the letter resource before it is depleted. Use the letters to identify the type of renewable energy resource described by the clues. a-4 n-1 b-1 o-3 d-1 r-3 e-3 s-3 g-1 t-2 h-1 w-2 i-2 l-2 m-2

a. Organic matter that can be burned to release energy.

b. It is caused by the sun's uneven heating of the Earth's surface.

c. It falls from the sky and flows downhill to empty into large bodies.

d. Energy resulting from the heating of the Earth's crust.

e. It is converted into electrical energy through cells on rooftops.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

What a Mess

4. Kristi dropped her backpack on her way to class. As a result, some important chapter terms got scrambled in with her lunch. Each term has combined with one lunch item. Help her unscramble them. Chapter Term a. pfeosasniult bufutetlers b. fjerictlilyon c. nobrunresneswelsable spresroouurtcess Lunch Item

18

HOLT SCIENCE AND TECHNOLOGY

Back

Name _______________________________________________ Date ________________ Class______________

Print

SCIENCE PUZZLERS, TWISTERS & TEASERS

Heat and Heat Technology

Fractured Frames

1. Solve these puzzles to reveal words from the chapter.

Absolute 0

Convect Heat

a.

text

b.

text

Wordy Numbers

2. Vanity phone numbers are numbers that can be spelled out in easy-to-remember words using the letters on a telephone keypad. For example, 878-6738 can spell TRUMPET. Use the keypad and these company mottoes to decide which word from the chapter each company uses for its number.

1

Copyright © by Holt, Rinehart and Winston. All rights reserved.

ABC

2

DEF

3 6 9

GHI

4

JKL

5 8 0

MNO

PRS

7

TUV

WXY

*

#

a. (324) 736-4348 "The oldest name in thermometers"

b. (467) 852-8466 "The heat stops here"

c. (266) 832-8466 "The best forced-air heating on the planet"

SCIENCE PUZZLERS, TWISTERS & TEASERS

19

Back

Name _______________________________________________ Date ________________ Class______________

Print

Heat and Heat Technology, continued

A Problem of Scale

3. The thermometers in Miss Messy's science class are not in very good shape. On some of them, the units have been rubbed off from use, while on others the scale marks are missing entirely. The school can't afford new thermometers, so her class has to make do with what they have. Melba and Mona are using thermometers with scale marks, but they do not know what units they designate. Malik found one that has readable degree markings, but the numbers have worn off, so he arbitrarily writes in new numbers with a marker. Manuel is using a thermometer that has no markings at all, so he has drawn degree markings randomly with a marker and chosen values for them. They all use the thermometers and obtain the following measurements.

Boiling water Melba Mona Malik Manuel 212 373 220 200 Ice water 32 273 40 0 Room temperature 68 293 76 40

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Body temperature

a. What kind of thermometer is Melba using?

b. What kind of thermometer is Mona using?

c. Before the numbers had worn off and Malik wrote in his own numbering system, what scale do you think this thermometer displayed?

d. What equation would you use to convert "degrees Manuel" into degrees Celsius?

e. If the class were allowed to use the thermometers to determine their normal body temperature, what would each thermometer read? Write your answers in the chart.

20

HOLT SCIENCE AND TECHNOLOGY

Back

Name _______________________________________________ Date ________________ Class______________

Print

SCIENCE PUZZLERS, TWISTERS & TEASERS

Introduction to Atoms

Mystery Guests

1. The three particles of an atom appeared recently on a talk show, and they stood behind a screen to hide their identities. (Not that you could see them anyway.) Identify their statements below, based on what you know about their characteristics. a. I don't mean to be negative all the time, but, well, I'm always on the go.

b. Me? I stay positive. It's the only way I know how to be.

c. I have almost no mass--no weight to throw around. And just once I'd like to be at the center of things.

d. I stay neutral on most nuclear issues.

e. When we (other particles just like me) outnumber the electrons, the whole atom has a more positive energy.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Sound Alikes

2. Each clue below will lead you to one or two short words. Combine the syllables to find the hidden terms, which are used in the study of atoms. a. Frozen water A breakfast grain A famous comedian named Bob; A TV hospital show: Chicago

b. A long skinny fish; one is electric

When the teacher speaks in class

The opposite of "offs"

SCIENCE PUZZLERS, TWISTERS & TEASERS

21

Back

Name _______________________________________________ Date ________________ Class______________

Print

Introduction to Atoms, continued

Double Puzzle

3. Use the clues below to fill in the blanks and boxes provided. Then arrange the letters from the boxes to answer the final riddle. a. Thompson's negative discovery b. a model English dessert c. Dalton knew oxygen and hydrogen were both these. d. Protons and electrons have this. e. a well tested, unifying explanation It's a central theme of this chapter:

Where's the Electron?

4. The exact position of an electron cannot be predicted by modern atomic theory. But you can make a guess. Find three true statements in a row, and you are in the electron's neighborhood! Place your answers (true or false) in the ring and circle the electron's neighborhood. b. a. All substances are made of atoms. b. Aristotle did not believe there was such a a. thing as an "atom." c. The idea of an "atom" has been around for only about 200 years. d. The negatively charged particles withj. in the atom are called electrons. e. A model is a representation of an object or a system. f. Rutherford proposed the center of the i. atom was a negatively charged nucleus. g. The positively charged particles within the nucleus are called protons. h. h. The particles in the nucleus that have no charge are called neutrons. g. i. The electrons contain most of the atom's mass. j. The diameter of the nucleus is about 1/100,000 the diameter of the atom.

c.

d.

e.

f.

22

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Back

Name _______________________________________________ Date ________________ Class______________

Print

SCIENCE PUZZLERS, TWISTERS & TEASERS

The Periodic Table

Periodic Crime

1. This is an eyewitness account of a crime recently committed. Which element committed the crime? "He was definitely a metal, but really soft, like you could cut him with a knife. As he ran past us, we squirted him with a water gun. He burst into flame! It was unbelievable. We almost had him cornered, but he pulled out a vial of chlorine gas and in the blink of an eye, he disappeared. All that was left was a pile of table salt."

Elements in the Round

2. Moving from the outside of the circle to the center of the circle, choose one letter from each ring to find the names of eight common elements. Write the names of the elements on the lines provided. Each letter will be used only once.

I

H

L

O

C

P

A

S

Copyright © by Holt, Rinehart and Winston. All rights reserved.

E

G

L

I

O

N

F

O

M

N

U

O

R

I

U

R

E

X

I

R

P

C

L

E

C

S

D

SCIENCE PUZZLERS, TWISTERS & TEASERS

E

Y

I

V

E

N

L

R

K

U

N

B

E

23

Back

Name _______________________________________________ Date ________________ Class______________

Print

The Periodic Table, continued

Elemental E-mail

3. A secret society of chemists has formed in order to discuss controversial chemistry issues over the Internet. To conceal their identities, the members use code names in their e-mail addresses. In the example below, Dr. Nancy Ann Fisher, who has the initials NAF, uses sodium fluoride, or NaF, for her e-mail address. (NOTE: When compounds are formed between two elements, the usual ending of the second element is replaced with "-ide.") For each e-mail address in the left column, write the appropriate chemical symbol in the right column. Then draw a line from the chemical symbol to the name of the person who would have that e-mail address. Email address Ex: [email protected] a. [email protected] b. [email protected] c. [email protected] d. [email protected] e. [email protected] f. [email protected] g. [email protected] h. [email protected] Chemical symbol NaF Name Salina Neruda Nancy Ann Fisher Pradesh Babu Francis Edwards Kinesha Breann Rosner Hannah Goldberg Michael Guy Helen Chin-Lee Antonio Guerra

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Ordered Squares

4. Each of the three squares below contains an eight-letter word related to the periodic table. The letters of each word are arranged in order in the square when you move either clockwise or counterclockwise. Write the words on the lines beneath the squares. A T E a. M L N O N b. N T S E E M E L c. I T C A N I D E

24

HOLT SCIENCE AND TECHNOLOGY

Back

Name _______________________________________________ Date ________________ Class______________

Print

SCIENCE PUZZLERS, TWISTERS & TEASERS

Chemical Bonding

Dancing Elements

1. A number of elements from the periodic table have shown up at the spring dance, and they are looking for dance partners. Their chemical identities are hidden in the first two letters of their names. Whether two elements will make good dance partners depends on the number of valence electrons they have. Examine the situations below and answer the questions. a. Nadine and Clark have sat at opposite ends of the table in science class since sixth grade. Clark thinks Nadine is cute, so he moves in closer. Will Nadine and Clark make good dance partners? Explain. If they could dance together, what type of bond would they form?

Copyright © by Holt, Rinehart and Winston. All rights reserved.

b. Florence and Floyd have a lot in common. They look alike, they act alike, and they both have the same number of valence electrons. Will Florence and Floyd make good dance partners? Explain. If they could dance together, what type of bond would they form?

c. Arlene has stood against the wall looking noble for most of the night. No one has approached her to dance, and she doesn't seem to mind. The dance is almost over. Will Arlene dance with anyone? If so, who? Explain.

SCIENCE PUZZLERS, TWISTERS & TEASERS

25

Back

Name _______________________________________________ Date ________________ Class______________

Print

Chemical Bonding, continued

d. Alton, Allison, Alexis and Albert have been dancing as a group for most of the evening. Now, the lights have been turned on and it's time to leave. Alton, Allison, Alexis and Albert have all had such a good time that they decide not to split up. Instead, they all leave together and go get fat-free yogurt malts. After tonight they will all remain close, despite many stressful situations. What type of bond do they share?

The Melting Pot

2. You left your Physical Science book on your desk overnight, open to the Chemical Bonding chapter. The chapter is so good at bonding that a few of the chapter terms have bonded with objects on your desk. Separate the objects from the terms below. (Hint: The letters are in the proper order, just mixed together.) Chapter Term a. tnotheeboroyok b. pcichetumircael fbraomend

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Desk Object

c. comomlepucuteler d. dipatoigmigyc mobalecunleks

Name That Bond

3. Name the type of bond described by each clue. a. They share and share alike, and they complete each other.

b. Negativity mingling with the hearts of others.

c. A positive heart and a negative heart come together. And together they are realistic (some call it neutral).

26

HOLT SCIENCE AND TECHNOLOGY

Back

Name _______________________________________________ Date ________________ Class______________

Print

SCIENCE PUZZLERS, TWISTERS & TEASERS

Chemical Reactions

If Chemistry Were Cooking

1. If chemistry were cooking, what kind of chemical reaction would each cooking experiment be? a. Taking eggs & toast and a ham & cheese sandwich and making a grilled cheese sandwich and eggs and ham.

b. Picking raisins out of raisin bran cereal.

c. Making a sandwich with peanut butter and jelly.

d. Picking meatballs out of spaghetti sauce then putting them into a meatball sandwich.

Be a Prefix Mathematician

2. Use the values of the prefixes to solve the mathematical equations. a. mono

Copyright © by Holt, Rinehart and Winston. All rights reserved.

di

tri

deca mono nona mono (deca hexa)) hepta) nona hexa)

b. di c. tetra d. tri e. (octa

(octa / (tri (penta tetra di

nona) (di

f. penta

tri)

Word Connections

3. Each of the following sentences contains a hidden word from the chapter. These words can be found by looking at part of one word somewhere in the sentence and connecting it to the beginning of the next word(s). For example, the word undo could be hidden between the words run, dogs. Circle the hidden word in each example. a. We're through, Jesco. Valentine's Day was the last straw. b. Do you like websites that end in .com? Pound for pound, I think they're the best.

SCIENCE PUZZLERS, TWISTERS & TEASERS

27

Back

Name _______________________________________________ Date ________________ Class______________

Print

Chemical Reactions, continued

Driving With Chemistry

4. Your friends Tommy and Karen are throwing a party, but not everyone is invited--only those who can decipher their directions! Your car is shown at the bottom. Drive straight until you reach an intersection. Answer the next question by circling the appropriate word. Turn right or left according to what column your answer is in. Repeat until you have answered all six questions.

Turn Right

a. If a reaction requires energy input to proceed, it is: b. If a reaction releases energy as it proceeds it is: c. If a chemical slows the rate of a reaction, it is a(n): d. If a chemical increases the rate of a reaction without being altered, it is a(n): e. In the reaction 4Fe + 3O2 f. In the reaction 4Fe + 3O2 2Fe2O3, Fe is a: 2Fe2O3, Fe2O3 is a: endothermic endothermic inhibitor inhibitor product product

Turn Left

exothermic exothermic catalyst catalyst reactant reactant

1

2

3

g. Which house did you arrive at?

28

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Back

Name _______________________________________________ Date ________________ Class______________

Print

SCIENCE PUZZLERS, TWISTERS & TEASERS

Chemical Compounds

Is There a Speaker in the House?

1. To be a good public speaker, you must state things clearly and simply. Unfortunately, when Congressman Hicks speaks, she just seems to ramble. Part of the reason may be her inability to choose the right words. Below is a speech Congressman Hicks is going to deliver in twenty minutes. Replace the underlined phrases with more concise terms from the chapter using the blanks provided. My fellow Americans, thank you for coming to participate in this open forum town meeting. While we may not be able to solve all of our community's problems tonight, I would like to touch (a.) any compound that increases the number of hydroxide ions when dissolved in water with you on some key issues. I don't want to come across too strongly when speaking of these things or seem to throw out words filled with (b.) any compound that increases the number of hydrogen ions when dissolved in water, but any leader worth her (c.) ionic compound formed from the positive ion of a base and the negative ion of an acid would have to stand up and be heard as I have. Thank you. a.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

b.

c.

A Clean, Well Lighted Place

2. Zach gets to prepare an entire dinner for his home economics class final. The foods in the class refrigerator are organized so that each food group has a shelf of its own. Unfortunately, some items have been placed on the wrong shelves. For each shelf below, circle the one item that does not belong. In the first space to the right of each shelf, identify the biochemical with which the food items on the shelf are usually identified. Use the second space to add each odd food item you circled to the shelf where it belongs. Biochemical a. beef, chicken, butter, beans b. vegetable oil, apples, cheese, bacon c. fish, oranges, bread, pasta Food Item Added

SCIENCE PUZZLERS, TWISTERS & TEASERS

29

Back

Name _______________________________________________ Date ________________ Class______________

Print

Chemical Compounds, continued

Until the Cows Come Home

3. Some terms from the chapter have gotten loose in the pasture, where they are trying to chemically combine themselves with other things around them. Separate them before the cows come home. Each example contains a word from the farm and two chapter terms. Write the terms in the correct blanks. From The Farm a. caocarcrtotsilieved b. hshyderopcaerbohpns c. nfesucanleclitec pacostids d. sobragacarsenice cocmropounwds 1st Chapter Term 2nd Chapter Term

Isn't That Ionic?

4. After the spring dance, a number of elements remained bonded. Listed below are groups of bonded atoms. They are identifiable by the atomic symbols in parentheses. Below that are situations that describe characteristics of the bondings. Match each group with a description by writing its atomic symbols in the blank.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Nate (Na) Claire (Cl) Hal (H) Hazel (H) Ophelia (O) a. At the dance, their bond just seemed to crystallize. It remained very strong as if nothing but extreme heat could cause a meltdown. But their tight bond tended to make them inflexible as a couple. When hammered with stress they tended to shatter.

What type of bond do they have? b. The attraction between these elements is weak, which allows them to remain fluid. Despite this, their attraction to each other is greater than their attraction to other compounds. Consequently, as a group they don't mix well with couples that have a similar bond.

What type of bond do they have?

30

HOLT SCIENCE AND TECHNOLOGY

Back

Name _______________________________________________ Date ________________ Class______________

Print

SCIENCE PUZZLERS, TWISTERS & TEASERS

Atomic Energy

Word Connections

1. Each of the following sentences includes a hidden word associated with atomic energy. These words can be found by looking at the end of one word and connecting it to the beginning of the next word. For example, the word dog could be hidden in Judo games. Circle the hidden words below. a. Derika will trade cayenne peppers for jalapeños. b. The extra ceremony is held to help ensure that everyone recognizes the scientists' accomplishments. c. Dr. Gunu cleared the room before he took the X ray.

Wasting Away

2. Fifty-one nuclei of radioactive atoms are releasing radiation through radioactive decay. There are three types of radioactive decay: alpha decay, beta decay, and gamma decay. Four times as many nuclei have gone through alpha decay as have gone through gamma decay. Fifteen more nuclei have gone through beta decay than have gone through alpha decay. Forty-seven nuclei have not gone through gamma decay. a. How many nuclei have gone through alpha decay?

Copyright © by Holt, Rinehart and Winston. All rights reserved.

b. How many nuclei have gone through beta decay?

c. How many nuclei have gone through gamma decay?

SCIENCE PUZZLERS, TWISTERS & TEASERS

31

Back

Name _______________________________________________ Date ________________ Class______________

Print

Atomic Energy, continued

Omission Puzzle

3. When combined and rearranged, the missing letters from the alphabets below will spell a word from the chapter. Puzzles with two alphabets use the letters missing from each. What are the words? a. ABCDEFGHIJKLMNQRUVWXYZ ABCDFGHJKLMNPQRTUVWXYZ

b.

ABCDEGHJKLMPQRTVWXYZ

c.

BCEFGHJKLMPQSUVWXYZ BCDEFGHJKLMNOPQRSTUVWXYZ

Code Cogs

4. In this system of interlocking cogs, the large cog rotates clockwise, causing the other cogs to move. The number of teeth for each cog is given, and each tooth is represented by a letter. Find the word from the chapter that will be spelled by the letters at the top of the wheels if the large wheel makes two complete rotations.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

B A I N E V

T

M R S T U O N I A P

U

H J K P R W

L

B

U A Q K I A

F

D O K M Y

O U J E N

R A V

O

F

S

E

S

M

S

C

12 T 14 T

10 T

8T

6T

4T

32

HOLT SCIENCE AND TECHNOLOGY

Back

Name _______________________________________________ Date ________________ Class______________

Print

SCIENCE PUZZLERS, TWISTERS & TEASERS

Introduction to Electricity

The Power Grid Maze

1. In this puzzle, the letters P-O-W-E-R are all conductors, and all X's are grounds. All other letters are neutral. A trail comes to a dead end any time one of the "power" letters borders an X. In order to complete the circuit from beginning to end, mark a trail of conducting letters that does not lead to a dead end. Power can run horizontally or vertically but not diagonally.

BEGIN

P O W X E

Z D C B H L G H L J M Q S U Y P E R P W J D C I K E R O X Z A O U V X M F X G V W I T V Z B R P S Q C Y X S T P E W E X F C R T N D A B L A R D L X I

Copyright © by Holt, Rinehart and Winston. All rights reserved.

R G D R O W P E E W O P L U G H

B H U G P A D D L E D P I G I R

A O N R W C X U V T V R E P P E

D W C S R X Y G W W P R D U X G

L R E P W D U Q E S T U B B T F

Y P F E O P X U R U N T S P Y N

T E I X P G I I O S H P W E E R

X E S W R H F L P T I O N E S P

S L H O W A X L P R R O T R A O

T E E W O Q U A C K S Z O O S W

U P M N P F A N G N U B A P T X

N W Q V O T E S T O T Q D W U Q

G R S M P L T W O P W O R E M S

T O T L W K V E T H C L A M P T

V P B Z R R E R G F G Z A T H A

EXIT

Series Circuits

2. The following series of words are arranged in circuits. In order for these circuits to function, each load (word) must be in working order. Misspelled words and those that are not vocabulary words from the chapter will cause the circuit to fail. Put a checkmark in the middle of functioning circuits and an X in the middle of nonfunctioning circuits. a.

Current Battery Induction Photocell

b.

Cell

Lightning Voltage Insulator

c.

Thermocouple

Resistunce Electric force Conduction

d.

Power lines

Static electricity Electric discharge Electric power SCIENCE PUZZLERS, TWISTERS & TEASERS

33

Back

Name _______________________________________________ Date ________________ Class______________

Print

Introduction to Electricity, continued

Wordy Numbers

3. Vanity phone numbers are numbers that can be spelled out in easy-to-remember words using the letters on a telephone keypad. For example, 878-6738 can spell TRUMPET. Use the keypad and the clues to decide which word from the chapter each number represents.

1 4

ABC

2

DEF

3 6 9

GHI

JKL

5 8 0

MNO

PRS

7

TUV

WXY

*

#

a. 242-7437 (A bull does it; objects have them.)

b. (266) 382-8677 (Trains and orchestras have them.)

Copyright © by Holt, Rinehart and Winston. All rights reserved.

c. (467) 852-8677 (Blankets are a type.)

d. (353) 287-4225 (A type of blanket)

e. 287-7368 (Up to date)

f. 865-8243 ("Age" of electricity)

34

HOLT SCIENCE AND TECHNOLOGY

Back

Name _______________________________________________ Date ________________ Class______________

Print

SCIENCE PUZZLERS, TWISTERS & TEASERS

Electromagnetism

Magnet Factory

1. There has been a major reorganization in the magnet factory and all of the files are out of order. The factory owners don't know which magnets belong to which quality inspection report. The reports indicate that there were three magnet sizes: small, medium, and large. One magnet is red, one blue, and one tan. The three magnet testers, Mike, Trey, and Page, were each responsible for testing one magnet. The testers used either a nail, a bolt, or a screw to test the magnets. You must use the clues provided below to match the magnets with their descriptions and testers so that the factory's files will be in proper order. The grid provided below may help you organize the information and solve the puzzle. Fill in the description of the magnet and what the magnet was tested with for each tester's report. Clues: · The small magnet is not held by Page, nor is it red. · The screw is not stuck to the medium magnet. · Mike's magnet is smaller than Page's. · The magnet attracting the nail is not blue. · Page's magnet is not attracting the screw. · The small magnet is tan, but the bolt is not stuck to it. · The medium magnet is not red. · The bolt is stuck to Mike's magnet. Place an X in the box if the descriptions belong to the same magnet. Place an O in the box if the descriptions belong to different magnets. sm. Mike Trey Page screw nail bolt blue red tan a. Mike b. Trey c. Page

SCIENCE PUZZLERS, TWISTERS & TEASERS

Copyright © by Holt, Rinehart and Winston. All rights reserved.

md.

lg.

blue

red

tan

screw

nail

bolt

35

Back

Name _______________________________________________ Date ________________ Class______________

Print

Electromagnetism, continued

Letters in Limbo

2. Determine if each of the following statements is true or false and circle the letter under the correct column. When you have completed the true or false statements, transfer the letters you circled to the blanks labeled with the corresponding question letter to answer the riddle. TRUE a. The Earth's magnetic pole in the Northern Hemisphere is actually a magnetic south pole. b. Copper and aluminum are generally not magnetic. c. Auroras are most often seen near the equator of the Earth. d. Electromagnets can be made strong enough to allow trains to levitate, or float, above the tracks. e. If you line up the north poles of two different magnets, they will be attracted to one another. f. Increasing the number of loops of wire in an electromagnet tends to make it weaker. g. The magnetic effects of a bar magnet are strongest at its poles. h. Temporary magnets are easy to magnetize and tend to keep their magnetic properties. i. To create a monopole, you must cut a bar magnet in half between the poles. j. Increasing the temperature of a magnet or striking it may cause it to lose its magnetic properties. What the iron nail said to the magnet: " ' i a h d c f j j O C L FALSE I D E

R

S

T

I

N V F H

A O U Y

Copyright © by Holt, Rinehart and Winston. All rights reserved.

T

M

!" d f b j e g c

36

HOLT SCIENCE AND TECHNOLOGY

Back

Name _______________________________________________ Date ________________ Class______________

Print

SCIENCE PUZZLERS, TWISTERS & TEASERS

Electronic Technology

Plug Me In

1. Professor Paowa has determined that the key to speedy galactic travel is to convert humans into electrical energy and beam them through space. To test her theory, she plugged her assistant Carrie into a wall socket. During Carrie's explorations she sent back the following questions about the electronic components she encountered. However, as electrical energy, Carrie was able to send questions much faster than Professor Paowa was able to answer them. Professor Paowa is now converting Carrie back to a human. Determine what the components were so that Professor Paowa can answer Carrie's questions. a. The device I am travelling through is pointed at what appears to be a big box with a screen. I just passed through a tiny bulb that sends out infrared light. What is this bulb called?

b. I have entered a different component, but I can't tell what it is. I passed through a gate and I'm not allowed to turn around. What is this component?

Copyright © by Holt, Rinehart and Winston. All rights reserved.

c. This component seems to be used as a switch or an amplifier. It has three layers of semiconductor sandwiched together. What is it?

d. I'm on a silicon chip. There are a lot of those sandwiched semiconductors here, as well as other circuit components. What is this thing?

SCIENCE PUZZLERS, TWISTERS & TEASERS

37

Back

Name _______________________________________________ Date ________________ Class______________

Print

Electronic Technology, continued

"E"asy Enough Without It

2. The following communications came across the wire via Morse code. However, because Dennis is inexperienced with the code, he translated them incorrectly. The following are anagrams of chapter terms. Omit an "e" from each statement and unscramble the remaining letters to reveal the correct word. (All answers consist of one word.) a. pine dog b. a single

text text

c. store trains

text

d. we had a rare

text

Cousins

3. The members of each of the lists below are related somehow, and the members of each group would not fit in with the other group. What is the common thread for each? a. compact discs, computers, cellular phones

b. televisions, seismographs, telephones

Working Barefoot

4. Jennifer wants to work away from the office three days a week. She knows that with a home computer she can do her work barefoot and e-mail it to her supervisor. She has purchased some computer equipment. Miguel, the salesperson, needs to box the equipment according to the function it performs. It is his first day on the job, and his nervousness has made him forget which component performs what function. Help Miguel by writing the correct terms on the correct boxes. monitor keyboard hard disk ROM mouse speaker microprocessor

processing

input

output

storage

38

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Back

Name _______________________________________________ Date ________________ Class______________

Print

SCIENCE PUZZLERS, TWISTERS & TEASERS

The Energy of Waves

Wave Rhyme Time

1. These clues describe two words that rhyme. In each example, one of the words is a term from the chapter. Write both words in the space provided. a. better than the rest, the highest point of a transverse wave

b. a section where the particles are less crowded than normal and yet maintain a good grip

Saxophones Don't Belong in Rock 'n Roll Bands

2. Ted plays the saxophone and enjoys rock 'n roll. He joined some bands so he could perform on stage. But, things didn't work out. Tell what problems Ted encountered in each band. a. In his first band, Ted played the baritone saxophone. However, when they played together, the crests of Ted's waves overlapped the troughs of Scott the bassist's waves. The result was a puny sound. Ted and Scott experienced:

Copyright © by Holt, Rinehart and Winston. All rights reserved.

b. In the next band, Ted really connected with the guitarist, Liz. Ted and Liz got into an intense jam session. At times, they produced some truly funky sound with large amplitude, thanks to constructive interference. But at other times their waves formed stationary patterns in which portions of the waves were at the rest position due to total destructive interference. Ted and Liz experienced a:

c. Finally, Ted joined a band called Fresh Squeezed. This band produced the hippest sounds of them all. Even the window panes seemed to be dancing to the music. But after a while, the windows began to break. As Fresh Squeezed continued to play, more and more glass broke. The band members decided that they couldn't afford to play together. The musicians and the glass windows experienced:

SCIENCE PUZZLERS, TWISTERS & TEASERS

39

Back

Name _______________________________________________ Date ________________ Class______________

Print

The Energy of Waves, continued

The Employment Section

3. Some terms from the chapter want to find jobs. They've been assigned the social security numbers listed below. Social security numbers are nine digit numbers issued by the U.S. government. Use the telephone keypad to translate the numbers into words and discover which terms are looking for jobs. A clue is provided for each problem.

1 4

ABC

2

DEF

3 6 9

GHI

JKL

5 8 0

MNO

PRS

7

TUV

WXY

*

a. 737-66-2623 (lingering)

#

c. 928-37-7333 (It isn't nearly fast enough for you.)

Savings

4. Some chapter terms have held jobs for a while, and they've opened savings accounts with the money they've earned. The accounts come with ten-digit account numbers, and each number is personalized for easy recall. Using the telephone keypad above, crack the number code to see which terms have savings accounts. Clues are provided. acct. a. 92835-36484 (Are we on the same one?)

acct. b. 73353-28466 (not only from mirrors)

40

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

b. 267-54-8833 (Can you turn it down?)

Back

Name _______________________________________________ Date ________________ Class______________

Print

SCIENCE PUZZLERS, TWISTERS & TEASERS

The Nature of Sound

Wordy Numbers

1. Vanity phone numbers are numbers that can be spelled out in easy-to-remember words. For example, a car dealer might choose the number 289-2277, which can be spelled as BUY CARS. What word from the chapter could each of the numbers below represent?

1 4

ABC

2

DEF

3 6 9

GHI

JKL

5 8 0

MNO

PRS

7

TUV

WXY

*

#

a. 367-7537 (Hint: What an effect!)

Copyright © by Holt, Rinehart and Winston. All rights reserved.

b. 332-4235 (Hint: The louder the bigger!)

c. 842-7283 (Hint: Some pagers do.)

d. (737) 662-6231 (Hint: Be sympathetic!)

e. 848-6337 (Hint: Are you ready to rumble?)

SCIENCE PUZZLERS, TWISTERS & TEASERS

41

Back

Name _______________________________________________ Date ________________ Class______________

Print

The Nature of Sound, continued

Code Breaker

2. See if you can decode the following secret message about waves that can't keep to themselves. The first word is given as a clue.

Rmgviuvivmxv lxxfih dsvm gdl li nliv hlfmw dzevh leviozk.

I n t er f ere nc e

Brain Teaser

3. When you pour liquid into a bottle, a sound is made. Without cheating and trying it on a real bottle, explain how the sound will change as liquid is added, and explain why this happens.

Riddle

4. I am made of anything but nothing. I am neither large nor small. Without me, there could be no sound. Wherever you go, I can be found. What am I?

42

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Back

Name _______________________________________________ Date ________________ Class______________

Print

SCIENCE PUZZLERS, TWISTERS & TEASERS

The Nature of Light

Team Colors

1. Five girls--Alissa, Bette, Cindy, Denise, and Esmé, met at a soccer tournament. Their uniforms were red, purple, blue, orange, and yellow (but not necessarily in that order). Use the clues to discover what color uniform each girl wore. Put an X in each space that is not the answer. Use a circle to show which girl wore which uniform. a. Cindy didn't have a purple uniform. b. Bette's uniform was blue or red. c. Denise would never wear purple or yellow. d. Alissa wasn't wearing orange or purple. e. Denise wore a red uniform. f. Cindy is taller than the girl with the yellow uniform and shorter than the girl with the blue uniform. Player Alissa Bette Cindy

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Red

Purple

Blue

Orange

Yellow

Denise Esmé

Coded Message

2. The following secret message was created using a substitution code. To write a substitution code, you first write out the numbers 1­26 in a line. You then choose a code word and write it above the numbers, matching each letter with a number. Next you assign the remaining letters of the alphabet, in alphabetical order, to the rest of the numbers. Remember, though, that once a letter has been coded, it is not coded again. For example, if the word is box, the code would look like this: boxacde... 1234567... The secret message tells you about the nature of light. Clue: This code word is "far from clear". 16 13 11 12 21 13 20 3 18 6 17 23 3 22 6.

SCIENCE PUZZLERS, TWISTERS & TEASERS

43

Back

Name _______________________________________________ Date ________________ Class______________

Print

The Nature of Light, continued

Word Paths

3. Light takes more than one path to get where it is going. In this puzzle, you will do the same with words. Look at the example below. You may want to circle each path as you figure it out. Then determine how many paths there are for each word. Fill in the table at the end of the problem.

Example:

Y A D A Y Y D A Y D A

Y A D Y D A Y

T

a. b.

E V A W V A V E E E

c.

H G I L I G H T G H T

Copyright © by Holt, Rinehart and Winston. All rights reserved.

T H T

M E M

Number of letters in word Number of word paths

2

3

4

5

4. a. Make a letter puzzle like the ones above with your first name. How many word paths can you take to spell it? If your name has more than five letters in it, you may want to use a nickname! b. Challenge: Find the formula that relates the number of letters in a word to the number of word paths you can use to spell it.

44

HOLT SCIENCE AND TECHNOLOGY

Back

Name _______________________________________________ Date ________________ Class______________

Print

SCIENCE PUZZLERS, TWISTERS & TEASERS

Light and Our World

Riddle-Eye-O

1. "See" if you can answer the riddles below. Write each item in the space provided. a. In bright light I hardly show, but dimness causes me to grow. b. Brown, green, hazel, or blue, I provide the eye its hue. c. I focus light to the back of the eye, and change shape for things far and nigh. d. I'm clear on my role to protect the eye and refract the light as it passes by. e. The back of the eye is where I am found; the real image forms on me, upside down.

Sound Alikes

2. Each clue below will lead you to one or two short words. Combine the syllables to find the hidden terms, which are used in the study of light. a. another word tunafish package going down a hill, for hotel or a plane going down to land

Copyright © by Holt, Rinehart and Winston. All rights reserved.

b. a machine for making rugs or fabric

not out but

She/ her He/him We/

c. what you mop in the kitchen

It comes between R and T.

a smell or odor

Word Connections

3. Each of the following sentences includes a hidden vocabulary word from the chapter. These words can be found by looking at part of one word and connecting it to the beginning of the next word. For example, dog could be hidden in Judo games. Circle the hidden words below. a. I eat popcorn each time I go to the movie theater. b. I rise very early in the morning.

SCIENCE PUZZLERS, TWISTERS & TEASERS

45

Back

Name _______________________________________________ Date ________________ Class______________

Print

Light and Our World, continued

Lights! Camera! Action!

4. Rearrange the letters in the camera below to form words related to light and technology.

b aracem

a. b.

a seral seral

c

sobificterp

c. d.

d

leptecose leptocose

e.

e roecomopeis crecomopis f galohorm

f.

Some Light Math

5. Choose a number greater than 0 and less than 21 and enter it in the first box. Then decide if each statement is true or false. Circle the mathematical statement under the column that matches your answer. Then perform that operation on your number, placing the new value into the next box. Answer all the questions this way. If the final number doesn't equal your original number, check your math and your knowledge of light! Starting number: TRUE a. Visible objects that are not a light source are luminous. b. Halogen lights were originally developed for airplanes. c. Neon light is emitted from energized atoms of certain gases. d. Vapor light is produced when electrons combine with water vapor. e. Light waves travel in straight lines. f. Light does not actually travel through a virtual image. g. Objects appear smaller in a convex mirror. h. A lens that is thicker at the edges than in the middle is a convex lens. 7 6 30 3 4 21 3 8 FALSE 9 3 20 2 5 20 9 11

Copyright © by Holt, Rinehart and Winston. All rights reserved.

46

HOLT SCIENCE AND TECHNOLOGY

Back

Print

Answer Key

Many of the questions in this workbook are open-ended and thus are intended to elicit thoughtful, creative responses. Therefore, in many cases a variety of correct answers are possible and any reasonable answer should be accepted. Suggested answers are provided below for open-ended questions as well as for questions that prompt students for morespecific responses.

Copyright © by Holt, Rinehart and Winston. All rights reserved.

The Properties of Matter, p. 3 1. a. The green ball is more dense, so it has more mass and therefore more inertia. b. wax: physical change c. wick: chemical change d. Binkie's inertia 2. a. Weight is a measure of the gravitational force on an object. b. Weight is varied depending on where the object is in relationship to the Earth (or any other large body in the universe). c. Weight is measured with a spring scale. d. Weight is expressed in newtons. 3. a. measure, matter, object b. constant, object, object, universe c. expressed, kilograms, grams, milligrams

Elements, Compounds, and Mixtures, p. 7 1. a. nonmetal b. metal c. metal d. metalloid e. nonmetal f. metalloid 2. solution 3. a. compound b. nonmetal c. mixtures 4. a. magnet b. filter c. distillation Matter and Motion, p. 9 1. a. gravity b. lubricant c. net force d. velocity e. unbalanced f. friction

SCIENCE PUZZLERS, TWISTERS & TEASERS

47

ANSWER KEY

The World of Physical Science, p. 1 1. a. graduated cylinder b. millimeter or micrometer 2. a. conclusion b. hypothesis c. density 3. a. volume b. theory c. law d. model e. area f. temperature g. meter

States of Matter, p. 5 1. a. Jar A is held by Jess and contains silicon dioxide, a solid. b. Jar B is held by Juan and contains nitrogen monoxide, a gas. c. Jar C is held by Jill and contains hydrogen hydroxide, a liquid. 2. plasma, gas, liquid, solid 3. melting, freezing, boiling vaporization, condensation, sublimation

Back

g. sliding h. newton 2. gravity 3. a. motion b. speed c. friction d. force

Print

c. machine d. fulcrum e. efficiency 4. Force is expressed in newtons. 5. Work is force times distance. Energy and Energy Resources, p. 17 1. a. potential, kinetic b. nuclear c. light 2. a. me, Chan. I calibrated mechanical b. potent! I already potential c. are sour celery resource 3. a. biomass b. wind c. water d. geothermal e. solar 4. a. fossil fuels, peanut butter b. friction, jelly c. nonrenewable resources, Brussels sprouts Heat and Heat Technology, p. 19 1. a. absolute zero b. convection heat 2. a. Fahrenheit b. insulation c. convection 3. a. Fahrenheit b. Kelvin c. Fahrenheit; he wrote in number designations 8 degrees below where they originally were. d. °M 2 °C e. Melba: 98.6 Mona: 310 Malik: 106.6 Manuel: 74 Introduction to Atoms, p. 21 1. a. electron b. proton c. electron d. neutron e. proton 2. a. isotope (ice oat Hope) b. electrons (eel lecture ons)

Forces in Motion, p. 11 1.

m3 o1 m3 e1 i1 n1 f4 o1 r1 c3 e1 r1 t1 c3 e1 n1 t1 r1 i1 a1 p3 e1 t1 a1 l1 e1 w4 n1 t1 u1 m3 a1 s1 s1 o1 n1

Forces in Fluids, p. 13 1. a. F b. T c. T d. F e. F Becky's robot is on Mount Everest (33 kPa). 2. a. crate A: 1.0 g/cm3, tan, soccer balls b. crate B: 0.5 g/cm3, blue, tennis balls c. crate C: 1.5 g/cm3, red, golf balls Work and Machines, p. 15 1. They are all types of inclined planes. 2. The clock's hand will point to 3:00. 3. a. pulleys b. Newtons

48

HOLT SCIENCE AND TECHNOLOGY

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Ashby's word: force 2. a. projectile motion b. orbit c. momentum d. action/reaction forces 3. Free fall and terminal velocity cannot share a room, because free fall requires a vacuum and terminal velocity occurs only when there is air resistance.

Back

Print

3. a. electron b. plum pudding c. elements d. charge e. theory atomic model 4. a. T b. T c. F d. T e. T f. F g. T h. T i. F j. T The electron's neighborhood is at j,a,b.

Chemical Bonding, p. 25 1. a. Yes; Nadine is a metal and willing to give up the single electron in her valence shell to become a positive ion. Clark is a nonmetal and willing to take on an electron to complete his valence shell to become a negative ion. The bond is ionic. b. Yes; they will each share an electron, completing their outer shells. It is a covalent bond. c. No; she is a noble gas with a full outer shell. d. metallic bond 2. a. theory, notebook b. chemical bond, picture frame c. molecule, computer d. diatomic molecules, piggy bank 3. a. covalent b. metallic c. ionic

Copyright © by Holt, Rinehart and Winston. All rights reserved.

Chemical Compounds, p. 29 1. 1. base 2. acid 3. salt 2. a. butter, protein, fish b. apples, lipid, butter c. fish, carbohydrate, apples 3. a. cattle, corrosive, acid b. sheep, hydrocarbons, pH c. fence post, nucleic acids, salt d. scarecrow, organic compounds, base 4. a. Nate(Na) Claire(Cl) ionic b. Hal(H) Hazel(H) Ophelia(O) covalent Atomic Energy, p. 31 1. a. trade cayenne decay b. extra ceremony tracer c. Gunu cleared nuclear 2. a. 16 b. 31 c. 4

SCIENCE PUZZLERS, TWISTERS & TEASERS

49

ANSWER KEY

The Periodic Table, p. 23 1. sodium 2. nickel, carbon, oxygen, helium, iodine, silver, copper, sulfur 3. a. Ag -- Antonio Guerra b. Mg -- Michael Guy c. HCl -- Helen Chin-Lee d. Sn -- Salina Neruda e. Fe -- Francis Edwards f. KBr -- Kinesha Breann Rosner g. Pb -- Pradesh Babu f. Hg -- Hannah Goldberg 4. a. nonmetal b. elements c. actinide

Chemical Reactions, p. 27 1. a. double replacement b. decomposition c. synthesis d. single replacement 2. a. 32 b. 3 c. 28 d. 19 e. -4 f. 0 3. a. Jesco. Valentine's covalent b. .com? Pound compound 4. a. endothermic (right) b. exothermic (left) c. inhibitor (right) d. catalyst (left) e. reactant (left) f. product (right) g. 2

Back

3. a. isotopes b. fusion c. radiation 4. tracer

Print

Introduction to Electricity, p. 33 1. There are two possible routes. 2. A is the only complete circuit. B contains a non-vocabulary word--lightning. C contains a misspelled word--resistance. D contains the non-vocabulary word power lines. 3. a. charges b. conductors c. insulators d. electrical e. current f. voltage Electromagnetism, p. 35 1. a. Mike has the blue, medium magnet with the bolt. b. Trey has the tan, small magnet with the screw. c. Page has the red, large magnet with the nail. 2. a. T b. T c. F d. T e. F f. F g. T h. F i. F j. T "You're attractive!" Electronic Technology, p. 37 1. a. light-emitting diode b. diode c. transistor d. integrated circuit 2. a. doping b. signal c. transistor d. hardware 3. a. digital b. analog 4. processing : microprocessor input: keyboard, mouse output: monitor, speaker storage: hard disk, ROM

The Energy of Waves, p. 39 1. a. best crest b. rarefaction traction 2. a. destructive interference b. standing wave c. resonance 3. a. resonance b. amplitude c. wave speed 4. a. wavelength b. reflection The Nature of Sound, p. 41 1. a. Doppler b. decibel c. vibrate d. resonance e. thunder 2. Interference occurs when two or more sound waves overlap. (The alphabet is written backwards with a 5-letter interval.) 3. The bottle acts as a resonator for its own natural frequencies. When liquid is poured in, it generates noise. The frequencies of this noise that match the natural frequency of the cavity will be amplified. As the cavity fills with liquid, the cavity gets smaller, and the wavelengths of its natural frequency get shorter. The pitch of the tone will thus get higher. 4. a medium The Nature of Light, p. 43 1. Alissa: yellow; Bette: blue; Cindy: orange; Denise: red; Esme: purple 2. Opaque is the codeword. Message: Light is an EM wave. 3. 2:2 3:4 4:8 5:16 4. a. Answers will vary. b. If p is the number of paths and n is the number of letters, then p 2(n­1). Light and Our World, p. 45 1. a. pupil b. iris

Copyright © by Holt, Rinehart and Winston. All rights reserved.

50

HOLT SCIENCE AND TECHNOLOGY

Back

Print

d. cornea e. retina 2. a. incandescent (inn can descent) b. luminous (loom in us) c. fluorescent (floor S scent) 3. a. popcorn each cornea b. I rise iris 4. a. laser

b. camera c. fiber optics d. telescope e. microscope f. hologram 5. a. F b. T c. T d. F e. T f. T g. T h. F

Copyright © by Holt, Rinehart and Winston. All rights reserved.

SCIENCE PUZZLERS, TWISTERS & TEASERS

51

ANSWER KEY

Information

HST_CRF_04_02_03.qxd

161 pages

Report File (DMCA)

Our content is added by our users. We aim to remove reported files within 1 working day. Please use this link to notify us:

Report this file as copyright or inappropriate

907359

You might also be interested in

BETA
HST_CRF_04_02_03.qxd
Harcourt Brace Science 2000